Overview

Brief Summary

The old-house borer (Hylotrupes bajulus) is a species of wood-boring beetle in the family Cerambycidae (longhorn beetles). Its larvae are pests of construction lumber and also infect dead wood in plantations. Originating in Europe, the old-house borer now has a worldwide distribution, including the Mediterranean, South Africa, Asia, USA and Canada, and Australia. In 1970, this pest was eradicated from Eastern Australia, but in 2004 it was found in Perth, Western Australia. A huge eradication campaign is underway and with hopes to contain the pest before it spreads with activities such as: door-knock surveys to locate potential pests, public education and report hotline, inspections of roofs in contaminated areas, trap pole placements, and training of detector dogs to recognize specific boring frequencies in lumber.

Only the old-house borer larvae feed on wood. Larvae prefer seasoned softwoods, particularly pine but also Douglas fir, and take two or three or more years to mature, depending on the moisture content of the wood. Larvae usually mature in the spring, and the mature adults then cut exit holes 6–10 mm in diameter. Because the beetle has a long life cycle and one generation is not sufficient time to cause major structural damage, containing the population in this first generation can be very effective for reducing loss. Treatment of building lumber is very important in reducing spread and infestation of beetles in structures. Adults are black or brown with grayish "hair" on their upper bodies and elytra (wing cases), and have shiny spots that resemble eyes. They are most active in the summer.

(Australian department of agriculture and food 2011; Wikipedia 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: ? lookout, Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Va., Virginia, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 235.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Unreadable, Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 235.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: R.I, Rhode Island, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: N.J., New Jersey, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Wash DC, Washington, D.C., United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant / internal feeder
larva of Hylotrupes bajulus feeds within old, seasoned wood of Pinopsida

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hylotrupes bajulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATAAATAATATAAGATTTTGACTTCTACCACCATCTCTAACTCTACTAGTATTAAGGAGAATTGTAGAAAATGGTGCAGGAACTGGGTGAACAGTATATCCTCCTCTTGCAGCAAACATTGCTCATAGAGGAGCATCTGTAGATCTTGCTATTTTTAGATTACACCTTGCAGGTGTATCATCAATTCTAGGAGCAGTTAATTTTATTTCAACAGTTATTAATATGCGACCTGAAGGTATACATCCTGAACGTATACCTTTATTTGTCTGAGCTGTAGTCATCACTGCAATTCTACTTTTATTATCTCTTCCTGTTCTTGCAGGTGCTATCACAATACTATTAACAGACCGAAATATTAATACATCCTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hylotrupes bajulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Old-house borer

Larvae of Hylotrupes bajulus exposed in infested wood

Hylotrupes bajulus is a species of wood-boring beetle variously known as the European House Borer, house longhorn beetle, Italian beetle, old-house borer, and other regional names.[1] The species is the only one described in that genus to date. In spite of the modest length of its antennae, it is a member of the family Cerambycidae, the longhorn beetles. It is the only Cerambycid beetle that re-infests the same wood that it emerged from.[citation needed] Originating in Europe, and having been spread in timber and wood products, the beetle now has a practically cosmopolitan distribution, including Southern Africa, Asia, the Americas, Australia, and much of Europe and the Mediterranean.

Hylotrupes bajulus preferentially attacks freshly produced softwood timber, particularly pine, so, contrary to the name "old-house borer", the species is more often found in new houses; this is mainly because the beetles are attracted to the higher resin content of wood harvested more recently than 10 years earlier. Another reason suggested is that new home construction may use wood already infected with the eggs of the beetles if the wood is not properly kiln-dried in production.[citation needed]

The life cycle from egg to egg typically takes two to ten years, depending on the type of wood, its age and and quality, its moisture content, whether it is sapwood or heartwood, and also depending on environmental conditions such as temperature. Only the larvae feed on the wood. Larvae usually pupate just beneath the wood surface and eclose in mid to late summer. Once the exoskeleton of the newly emerged adult beetle has hardened sufficiently the adults cut oval exit holes 6–10 mm (¼ to 3/8 in) in diameter, typically leaving coarse, powdery frass in the vicinity of the hole.[2] Adults are most active in the summer. They are brown to black, appearing grey because of a fine grey furriness on most of the upper surface. On the pronotum two conspicuously hairless tubercles are characteristic of the species.

References[edit]

  1. ^ Victoria Government Gazette No. G 13 Thursday 27 March 2014 [www.gazette.vic.gov.au]
  2. ^ The Old House Borer, Penn State Department of Entomology web site


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!