Overview

Brief Summary

The old-house borer (Hylotrupes bajulus) is a species of wood-boring beetle in the family Cerambycidae (longhorn beetles). Its larvae are pests of construction lumber and also infect dead wood in plantations. Originating in Europe, the old-house borer now has a worldwide distribution, including the Mediterranean, South Africa, Asia, USA and Canada, and Australia. In 1970, this pest was eradicated from Eastern Australia, but in 2004 it was found in Perth, Western Australia. A huge eradication campaign is underway and with hopes to contain the pest before it spreads with activities such as: door-knock surveys to locate potential pests, public education and report hotline, inspections of roofs in contaminated areas, trap pole placements, and training of detector dogs to recognize specific boring frequencies in lumber.

Only the old-house borer larvae feed on wood. Larvae prefer seasoned softwoods, particularly pine but also Douglas fir, and take two or three or more years to mature, depending on the moisture content of the wood. Larvae usually mature in the spring, and the mature adults then cut exit holes 6–10 mm in diameter. Because the beetle has a long life cycle and one generation is not sufficient time to cause major structural damage, containing the population in this first generation can be very effective for reducing loss. Treatment of building lumber is very important in reducing spread and infestation of beetles in structures. Adults are black or brown with grayish "hair" on their upper bodies and elytra (wing cases), and have shiny spots that resemble eyes. They are most active in the summer.

(Australian department of agriculture and food 2011; Wikipedia 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: ? lookout, Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Va., Virginia, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 235.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Unreadable, Unknown, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 235.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: R.I, Rhode Island, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: N.J., New Jersey, United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 234.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Hylotrupes bajulus
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Collector(s): Unknown
Locality: Wash DC, Washington, D.C., United States
  • Type: Casey, T. L. 1924. Memoirs on the Coleoptera. 11: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Foodplant / internal feeder
larva of Hylotrupes bajulus feeds within old, seasoned wood of Pinopsida

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hylotrupes bajulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATAAATAATATAAGATTTTGACTTCTACCACCATCTCTAACTCTACTAGTATTAAGGAGAATTGTAGAAAATGGTGCAGGAACTGGGTGAACAGTATATCCTCCTCTTGCAGCAAACATTGCTCATAGAGGAGCATCTGTAGATCTTGCTATTTTTAGATTACACCTTGCAGGTGTATCATCAATTCTAGGAGCAGTTAATTTTATTTCAACAGTTATTAATATGCGACCTGAAGGTATACATCCTGAACGTATACCTTTATTTGTCTGAGCTGTAGTCATCACTGCAATTCTACTTTTATTATCTCTTCCTGTTCTTGCAGGTGCTATCACAATACTATTAACAGACCGAAATATTAATACATCCTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTCTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hylotrupes bajulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Old-house borer

The old-house borer, or house longhorn beetle (Hylotrupes bajulus) is a species of wood-boring beetle in the family Cerambycidae (longhorn beetles) and is the only Cerambycidae beetle that re-infests the same wood that it emerged from. Contrary to its name, it is more often found in new houses; this is in part because new home construction may use wood infected with the beetle's eggs if the wood is not properly kiln-dried in production but is mostly due to the beetles need for the higher resin content found in wood less than 10 years old. Originating in Europe, the old-house borer now has a worldwide distribution, including the Mediterranean, South Africa, Asia, USA and Canada. Recently it has been found in Perth, Australia. In Australia, it is known as the European House Borer.[1]

Old-house borers prefer new softwoods, and particularly pine. Only the larvae feed on the wood. Larvae take up to thirty years to mature, depending on the moisture content of the wood and environmental conditions but typically mature in three to fifteen years, damaging the wood in the interim. Larvae usually mature in mid to late summer (July–August in the northern hemisphere), and the mature adults then cut large oval shaped exit holes 6–10 mm (¼ to 3/8 in) in diameter to exit the wood, leaving course powdery frass around the vicinity of the hole.[2] Adults are most active in the summer. They are black or brown with grayish "hair" on their upper bodies and wing cases. They have shiny spots that resemble eyes.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!