Articles on this page are available in 1 other language: French (4) (learn more)

Overview

Comprehensive Description

Genus Tetramorium HNS Mayr, 1855

Tetramorium HNS Mayr, 1855: Verh. Zool. Bot. Ges. Wien.5: 423.

Type-species: Formica caespitum L. HNS ,1758: Syst. Nat., ed.10: 581.

Distribution: Palaearctic, Ethiopian, Oriental, Australian, Polynesian, Nearctic & Neotropical regions.

Key to species

1 Body length 2.5 mm, propodeal spines relatively longer (Fig.42) ....................... ........................... T. brevicorne Brondroit HNS

- Body length 3.5 mm, propodeal spines short .......................................................2

2- Dorsum of head with a distinct median depression, propodeal spines short and acute (Fig.43)............ T. depressicepes Menozzi HNS

- Dorsum of head without a median depression, propodeal armature tuberculate and blunt (Fig.44)............... T. salwae HNS n.sp.

  • Mohamed, S., Zalat, S., Fadl, H. (2001): Taxonomy of ant species (Hymenoptera: Formicidae) collected by pitfall traps from Sinai and Delta region, Egypt. Egyptian Journal of Natural History 3, 40-61: 54-55, URL:http://plazi.org:8080/dspace/handle/10199/16666
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium HNS sp. *

North Iran

T. moravicum HNS .

Det. Radchenko

  • Paknia, O., Radchenko, A., Alipanah, H. (2008): A preliminary checklist of the ants (Hymenoptera: Formicidae) of Iran. Myrmecologische Nachrichten 11, 151-159: 155-155, URL:http://antbase.org/ants/publications/21820/21820.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium HNS chefketi Forel, 1911 *

North Iran.

Det. Collingwood

ALIPANAH & al. (1995), HMIM

  • Paknia, O., Radchenko, A., Alipanah, H. (2008): A preliminary checklist of the ants (Hymenoptera: Formicidae) of Iran. Myrmecologische Nachrichten 11, 151-159: 155-155, URL:http://antbase.org/ants/publications/21820/21820.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium HNS cf. caespitum HNS (Linnaeus, 1758) *

North and South Iran.

Det. Cook

Crawley (1920a), PAKNIA & KAMI (2007), ZMGU

  • Paknia, O., Radchenko, A., Alipanah, H. (2008): A preliminary checklist of the ants (Hymenoptera: Formicidae) of Iran. Myrmecologische Nachrichten 11, 151-159: 155-155, URL:http://antbase.org/ants/publications/21820/21820.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium HNS Mayr

Worker small, monomorphic. Antennae 12-jointed, with a 3-jointed club. Clypeus narrowed on the sides where its posterior margin is raised in the form of a short trenchant ridge or carina as the anterior border of the antennal socket. Frontal carinae rather far apart, usually continued back some distance and often the full length of the head as subparallel ridges forming the inner borders of scrobes or demiscrobes for the accommodation of the antennal scapes. Maxillary palpi 4-jointed; labial palpi 3-jointed. Eyes well developed; ocelli absent. Mandibles rather large, triangular, their apical border with a few large and several small teeth. Premesonotal suture indistinct, mesoepinotal suture more or less distinct; mesoepinotal constriction usually feeble; epinotum with two spines or teeth and episterna usually spined or dentate. Petiole with a short but distinct peduncle and the node large, subcuboidal, rounded above, rarely squamiform; the postpetiole usually broader than the petiole. Legs rather short, middle and hind tibiae with small, simple spurs. Head, thorax, and petiole sculptured, usually rugose or reticulate rugose.

Female resembling the worker, but somewhat larger. Pronotum usually very little exposed above; mesonotum and scutellum raised above the level of the pro- and epinotum, the latter with stouter and shorter spines than in the worker. Fore wing with one cubital, one discoidal, and a closed radial cell.

Male slightly smaller than the female, with 10-jointed, very exceptionally with 12- or 13-jointed antennae. Second funicular joint very long, representing a fusion of 4 joints. Head small, ocelli and eyes large. Mandibles small but dentate. Pronotum overarched by the mesonotum, which has distinct Mayrian furrows. Epinotum truncate and dentate. Wings as in the female.

This genus might be described as peculiar to the Old World, because nearly all the few species occuring in America ( T. caespitum HNS , simillimum HNS , and guineense HNS ) are known to have been introduced by commerce. The group reaches its greatest development in the Ethiopian Region so far as the number of species, subspecies, and varieties is concerned. Arnold has included Triglyphothrix, Xiphomyrmex HNS , and Decamorium HNS as subgenera, but I have treated them as genera, though a few species with simple hairs may be assigned indifferently either to Tetramorium HNS or Triglyphothrix. I have still further reduced the size of the genus Tetramorium HNS by establishing a new genus , Macromischoides HNS , for T. africanum HNS and aculeatum HNS (vide supra). The species of Tetramorium HNS form moderately large colonies and nest in the ground, usually under stones or logs. One of the species, T. caespitum HNS , has a remarkable distribution, ranging from Britain to Japan, around the shores of the Mediterranean, and reappearing at higher elevations on Mt. Kilimanjaro.

  • Wheeler, W. M. (1922): The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45, 39-269: 190-191, URL:http://plazi.org:8080/dspace/handle/10199/17097
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Tetramorium HNS Mayr, 1855

Tetramorium HNS Mayr, 1855:423.

Type-species: Formica caespitum Linne HNS , 1758.

Worker and queen. Lateral margins of clypeus raised into a ridge in front of antennal insertions; mandibles with 3 strong apical teeth followed by a row of smaller denticles. Sting with lamelliform appendage. Pronotum of worker distinctly angled anterolaterally. Body hairs simple.

Male. Antennae 10 segmented with elongate second funiculus segment, mandibles dentate. Body hairs simple.

This is a very large genus with several hundred species mainly distributed throughout the palaeotropic and palaearctic regions. One species is native in North Europe and one or more subtropical cosmopolitan species are occasionally introduced and may become established in heated premises.

Keys to species of Tetramorium HNS

Workers and queens

1 Frontal carinae short; body colour brownish black............ 28. caespitum (Linne) HNS

Frontal carinae extended backwards as longitudinal ridges almost to occipital margin; body colour yellowish to reddish brown.............................................. 2

2(1) Dorsum of alitrunk and petiole nodes coarsely rugulose; body hairs long and numerous. Queen has first gaster tergite with fine longitudinal striae at base (Fig. 113)...................................................................... bicarinatum (Nylander) HNS

Alitrunk finely rugulose with numerous punctures; body hairs short and sparse. Queen has postpetiole and first gaster tergite finely punctulate simillimum (Smith) HNS

Figs. 110-112. Tetramorium caespitum (L.) HNS . - 110: worker in dorsal view; 111: antennal insertion in anterolateral view, showing raised clypeal border; 112: male in profile. Scale: 1 mm.

Fig. 113. Tetramorium bicarinatum (Nyl.) HNS , head of worker in dorsal view.

Males

Tetramorium bicarinatum HNS (Nylander, 1846) [stat. rev. Bolton, 1977]

Fig. 113.

Myrmica bicarinata Nylander HNS , 1846b: 1061.

Worker and queen. Pale reddish, coarse reticulo-rugulose sculpture; frontal carinae

1 Postpetiole smooth and shining............................................ simillimum (Smith) HNS

Postpetiole punctured or regulose .................................................................. 2

2(1) Head and alitrunk yellowish brown. Frontal carinae extend backward to level of ocelli ........................................................................ bicarinatum (Nylander) HNS

Head and alitrunk blackish brown. Frontal carinae short 28. caespitum (Linne) HNS

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 82-84, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Tetramorium Mayr HNS

There is one native species of Tetramorium HNS in California, T. spinosum (Pergande) HNS , which occurs in open dry habitats of southern California, and one introduced European species, T. caespitum (Linnaeus) HNS (the pavement ant), which is found in urban and agricultural areas of central and northern California. Both are ground-nesting, with generalist foraging habits. Four other non-native species, of tropical origin, have been recorded occasionally from the state.

Species identification: keys in Bolton (1979). Additional references: Astruc et al. (2001), Brown (1957d), Bruder and Gupta (1972), Knight and Rust (1990), Longhurst et al. (1980), Martinez (1993), Merickel and Clark (1994), Sanetra and Buschinger (2000), Steiner et al. (2005).

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 37-37, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium Mayr HNS , 1855

Taxonomy. The genus Tetramorium HNS is assigned to the tribe Tetramoriini HNS (for a complete taxonomic history see Bolton 2003). The Oriental species were revised by Bolton (1976, 1977). Workers of Vietnamese species have the following features.

Worker monomorphic; head in full-face view subrectangular, with rounded posterior corners; frontal carina usually (but not always) long and distinct; antennal scrobe weak or absent; anteromedian margin of clypeus weakly convex, often with a weak emargination at midpoint, lacking any denticles or teeth; an isolated median seta absent; posteromedian portion of clypeus very broadly inserted between frontal lobes; lateral portion of clypeus modified into a distinct ridge or wall in front of antennal insertion; mandible triangular; masticatory margin with apical and 1 or 2 larger preapical teeth followed by some smaller teeth or minute denticles; palp formula 4,3; antennae 11- or 12-segmented, with 3-segmented club; basal rim of shaft of antennal scape often forming an enlarged lobe expanding ventrad; eye medium to large in size; mesosoma in lateral view weakly convex dorsad; promesonotal suture absent dorsally; metanotal groove absent; anterior part of mesopleuron forming a flange projecting over basal part of fore coxa; propodeal spine present, varying in size and shape; propodeal lobe well developed usually as a triangular lamella or spinose projection but sometimes as a subrectangular or round lamella; petiole pedunculate, with distinct node; a tiny denticle or process present on the anteriormost part of ventral face of peduncle (it is often concealed by mesopleuron and or hind coxa in lateral view); gastral shoulder distinct to absent; apex of sting with a small lamellate appendage; head and mesosoma usually strongly reticulate or rugoso-reticulate.

The worker of Tetramorium HNS is similar to those of Rhoptromyrmex HNS and Myrmica HNS (for distingusihing characters see under the latter genera)

Vietnamese species. Four species have been described from Vietnam: indosinense Wheeler HNS [= sp. eg-13] (Type locality: Ha Noi; other locality: Ba Vi); infraspinosum Karaviev HNS (type locality: Cau Da); kieti Roncin (type locality: Vietnam); secure Roncin (type locality: Vietnam). An additional 21 species have recognized by us from Vietnam: flavipes Emery HNS [= sp. eg-4; = sp. 39 of SKY: Yamane et al., 2003] (Ba Vi, Chua Yen Tu, Cuc Phuong, Nam Cat Tien, Phu Quoc, Pu Mat, Tay Yen Tu, Van Ban); kheperra HNS (Bolton) [= sp. eg-9] (Ba Vi, Phu Quoc, Tay Ye n T u); lanuginosum Mayr HNS [= sp. eg-17] (Ba Vi, Bac Kan, Tam Dao); nipponense Wheeler HNS [= sp. eg-5] (Ba Be, Ba Vi, Cuc Phuong, Sa Pa, My Yen, Pu Mat, Tay Yen Tu, Van Ban); sp. eg-1 (Sa Pa); sp. eg-2 [= kraepelini Forel HNS : Eguchi et al., 2005] (Ba Vi, Nam Cat Tien, Phu Quoc, Pu Mat, Tay Yen Tu); sp. eg-3 [= sp. 32 of SKY: Eguchi et al., 2005] (Ba Vi, Chua Yen Tu, Tam Dao, Tay Yen Tu, Van Ban); sp. eg-6 [cf. pacificum Mayr HNS ] (Sa Pa, Pu Mat); sp. eg-7 (Sa Pa); sp. eg-8 (Ba Be); sp. eg-10 (Tay Yen Tu); sp. eg-12 (Ba Vi, Pu Mat); sp. eg-14 (Binh Chau-Phuoc Buu); sp. eg-15 [= bicarinatum HNS (Nylander): Eguchi et al., 2005] (Tam Dao); sp. eg-16 [= smithi Mayr HNS : Eguchi et al., 2005] (Ba Vi); sp. eg-18 [= walshi HNS (Forel): Yamane et al., 2003] (Cuc Phuong, My Yen, Pu Mat); sp. eg-19 (Ba Be); sp. eg-21 (Cuc Phuong); sp. eg-22 (Nam Cat Tien); sp. eg-23 (Nam Cat Tien, Nui Chua); sp. eg-24 (Nam Cat Tien).

Bionomics. Tetramorium HNS species inhabit various habitats such as open lands, grasslands, forest edges and well-developed forests. Their nests are usually found in rotting logs, twigs, wood fragments, under stones and in soil. Workers forage mainly on the ground.

  • Eguchi, K., Viet, B. T., Yamane, S. (2011): Generic synopsis of the Formicidae of Vietnam (Insecta: Hymenoptera), Part I - Myrmicinae and Pseudomyrmicinae. Zootaxa 2878, 1-61: 30-30, URL:http://antbase.org/ants/publications/23462/23462.pdf
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ Genus Tetramorium Mayr HNS ]]

Tetramorium Mayr HNS , 1855 is one of the most diverse ant genera comprising more than 400 species worldwide (Bolton, 1995a). Modern taxonomic revisions of this genus were carried out by Bolton (1976, 1977, 1979, 1980) for all zoogeographical regions except for the Palaearctic Region.

Although tropical Tetramorium HNS species have very diverse biologies (habitat requirements, food preferences, nesting habits, etc.) the bionomics of the Palaearctic species is more or less uniform. They build nests mainly in the ground, often with soil mounds, frequently under stones and, rarely, in rotten wood. Biology, distribution and the life cycle of Tetramorium caespitum HNS ( López et al. 1990; López et al. 1992; Sanetra et al. 1999; Attygalle & Morgan 1984; Brian et al. 1967; Cammaerts & Cammaerts 2000, 2001; Gallé 1986; Sanetra & Buschinger 2000; Steiner et al. 2003) and related T. impurum HNS ( Stäger 1929; Poldi 1963; Cammaerts et al. 1984; Steiner et al. 2003; Csösz & Markó 2004)have been very well studied but other Palaearctic Tetramorium HNS species have been little represented other than faunistic surveys. Colonies of Palaearctic Tetramorium HNS are sometimes inhabited by several tens of thousands of workers and generally they live in dry and warm or even hot habitats including steppes and steppe-like grasslands, semi-deserts or deserts.

The first taxonomic revision (Emery 1909) of the Palaearctic Tetramorium HNS includes five species and about 20 infraspecific forms. Later several reviews of the genus from different parts of the Western Palaearctic were provided by Santschi (1927), Stitz (1939) and Kratochvíl (1944); many infraspecific taxa were described by other authors. More recently, data on Palaearctic Tetramorium HNS were published in regional monographs or special taxonomic papers, including descriptions of several new species from Morocco (Cagniant 1997), Iberian Peninsula ( López 1991a, 1991b; López et al. 1992), South Europe (Bernard 1967), Balkans, Europe (Agosti & Collingwood 1987a, 1987b), Switzerland (Kutter 1977), North Europe (Collingwood 1979), Italy (Mei 1995; Sanetra et al. 1999), Germany (Schulz 1996; Seifert 1996), Poland (Radchenko et al. 1998), European part of the former Soviet Union and Caucasus (Arnoldi 1968; Radchenko & Arakelyan 1990), former Soviet Union (Radchenko 1992a, 1992b), Kazakhstan (Bursakov 1984), Turkmenistan (Dlussky & Zabelin 1985; Dlussky et al. 1990), Afghanistan (Pisarski 1967a, 1967b, 1969), Turkey (Poldi 1979), Saudi Arabia (Collingwood1985; Collingwood & Agosti 1996), China (Wang et al. 1988; Xu & Zheng 1994; Zhou & Jiang 1998), Japan (Imai et al. 2003). As a result, about 60 species and infraspecific forms of Tetramorium HNS were recorded from the Palaearctic up to now, mostly from the southern part of the region.

  • Csösz S., Radchenko, A., Schulz, A. (2007): Taxonomic revision of the Palaearctic Tetramorium chefketi species complex (Hymenoptera: Formicidae). Zootaxa 1405, 1-38: 2-2, URL:http://hdl.handle.net/10199/16745
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Tetramorium Mayr , 1855 is one of the most diverse ant genera comprising more than 400 species worldwide (Bolton, 1995a). Modern taxonomic revisions of this genus were carried out by Bolton (1976, 1977, 1979, 1980) for all zoogeographical regions except for the Palaearctic Region.

 

Although tropical Tetramorium species have very diverse biologies (habitat requirements, food preferences, nesting habits, etc.) the bionomics of the Palaearctic species is more or less uniform. They build nests mainly in the ground, often with soil mounds, frequently under stones and, rarely, in rotten wood. Biology, distribution and the life cycle of Tetramorium caespitum ( López et al. 1990; López et al. 1992; Sanetra et al. 1999; Attygalle & Morgan 1984; Brian et al. 1967; Cammaerts & Cammaerts 2000, 2001; Gallé 1986; Sanetra & Buschinger 2000; Steiner et al. 2003) and related T. impurum ( Stäger 1929; Poldi 1963; Cammaerts et al. 1984; Steiner et al. 2003; Csösz & Markó 2004)have been very well studied but other Palaearctic Tetramorium species have been little represented other than faunistic surveys. Colonies of Palaearctic Tetramorium are sometimes inhabited by several tens of thousands of workers and generally they live in dry and warm or even hot habitats including steppes and steppe-like grasslands, semi-deserts or deserts.

 

The first taxonomic revision (Emery 1909) of the Palaearctic Tetramorium includes five species and about 20 infraspecific forms. Later several reviews of the genus from different parts of the Western Palaearctic were provided by Santschi (1927), Stitz (1939) and Kratochvíl (1944); many infraspecific taxa were described by other authors. More recently, data on Palaearctic Tetramorium were published in regional monographs or special taxonomic papers, including descriptions of several new species from Morocco (Cagniant 1997), Iberian Peninsula ( López 1991a, 1991b; López et al. 1992), South Europe (Bernard 1967), Balkans, Europe (Agosti & Collingwood 1987a, 1987b), Switzerland (Kutter 1977), North Europe (Collingwood 1979), Italy (Mei 1995; Sanetra et al. 1999), Germany (Schulz 1996; Seifert 1996), Poland (Radchenko et al. 1998), European part of the former Soviet Union and Caucasus (Arnoldi 1968; Radchenko & Arakelyan 1990), former Soviet Union (Radchenko 1992a, 1992b), Kazakhstan (Bursakov 1984), Turkmenistan (Dlussky & Zabelin 1985; Dlussky et al. 1990), Afghanistan (Pisarski 1967a, 1967b, 1969), Turkey (Poldi 1979), Saudi Arabia (Collingwood1985; Collingwood & Agosti 1996), China (Wang et al. 1988; Xu & Zheng 1994; Zhou & Jiang 1998), Japan (Imai et al. 2003). As a result, about 60 species and infraspecific forms of Tetramorium were recorded from the Palaearctic up to now, mostly from the southern part of the region.

License not applicable

Csösz S.

Source: Plazi.org

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Taxonomy. The genus Tetramorium is assigned to the tribe Tetramoriini (for a complete taxonomic history see Bolton 2003). The Oriental species were revised by Bolton (1976, 1977). Workers of Vietnamese species have the following features.

 

Worker monomorphic; head in full-face view subrectangular, with rounded posterior corners; frontal carina usually (but not always) long and distinct; antennal scrobe weak or absent; anteromedian margin of clypeus weakly convex, often with a weak emargination at midpoint, lacking any denticles or teeth; an isolated median seta absent; posteromedian portion of clypeus very broadly inserted between frontal lobes; lateral portion of clypeus modified into a distinct ridge or wall in front of antennal insertion; mandible triangular; masticatory margin with apical and 1 or 2 larger preapical teeth followed by some smaller teeth or minute denticles; palp formula 4,3; antennae 11- or 12-segmented, with 3-segmented club; basal rim of shaft of antennal scape often forming an enlarged lobe expanding ventrad; eye medium to large in size; mesosoma in lateral view weakly convex dorsad; promesonotal suture absent dorsally; metanotal groove absent; anterior part of mesopleuron forming a flange projecting over basal part of fore coxa; propodeal spine present, varying in size and shape; propodeal lobe well developed usually as a triangular lamella or spinose projection but sometimes as a subrectangular or round lamella; petiole pedunculate, with distinct node; a tiny denticle or process present on the anteriormost part of ventral face of peduncle (it is often concealed by mesopleuron and or hind coxa in lateral view); gastral shoulder distinct to absent; apex of sting with a small lamellate appendage; head and mesosoma usually strongly reticulate or rugoso-reticulate.

 

The worker of Tetramorium is similar to those of Rhoptromyrmex and Myrmica (for distingusihing characters see under the latter genera)

 

Vietnamese species. Four species have been described from Vietnam: indosinense Wheeler [= sp. eg-13] (Type locality: Ha Noi; other locality: Ba Vi); infraspinosum Karaviev (type locality: Cau Da); kieti Roncin (type locality: Vietnam); secure Roncin (type locality: Vietnam). An additional 21 species have recognized by us from Vietnam: flavipes Emery [= sp. eg-4; = sp. 39 of SKY: Yamane et al., 2003] (Ba Vi, Chua Yen Tu, Cuc Phuong, Nam Cat Tien, Phu Quoc, Pu Mat, Tay Yen Tu, Van Ban); kheperra (Bolton) [= sp. eg-9] (Ba Vi, Phu Quoc, Tay Ye n T u); lanuginosum Mayr [= sp. eg-17] (Ba Vi, Bac Kan, Tam Dao); nipponense Wheeler [= sp. eg-5] (Ba Be, Ba Vi, Cuc Phuong, Sa Pa, My Yen, Pu Mat, Tay Yen Tu, Van Ban); sp. eg-1 (Sa Pa); sp. eg-2 [= kraepelini Forel : Eguchi et al., 2005] (Ba Vi, Nam Cat Tien, Phu Quoc, Pu Mat, Tay Yen Tu); sp. eg-3 [= sp. 32 of SKY: Eguchi et al., 2005] (Ba Vi, Chua Yen Tu, Tam Dao, Tay Yen Tu, Van Ban); sp. eg-6 [cf. pacificum Mayr ] (Sa Pa, Pu Mat); sp. eg-7 (Sa Pa); sp. eg-8 (Ba Be); sp. eg-10 (Tay Yen Tu); sp. eg-12 (Ba Vi, Pu Mat); sp. eg-14 (Binh Chau-Phuoc Buu); sp. eg-15 [= bicarinatum (Nylander): Eguchi et al., 2005] (Tam Dao); sp. eg-16 [= smithi Mayr : Eguchi et al., 2005] (Ba Vi); sp. eg-18 [= walshi (Forel): Yamane et al., 2003] (Cuc Phuong, My Yen, Pu Mat); sp. eg-19 (Ba Be); sp. eg-21 (Cuc Phuong); sp. eg-22 (Nam Cat Tien); sp. eg-23 (Nam Cat Tien, Nui Chua); sp. eg-24 (Nam Cat Tien).

 

Bionomics. Tetramorium species inhabit various habitats such as open lands, grasslands, forest edges and well-developed forests. Their nests are usually found in rotting logs, twigs, wood fragments, under stones and in soil. Workers forage mainly on the ground.

License not applicable

Eguchi, K.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Worker small, monomorphic. Antennae 12-jointed, with a 3-jointed club. Clypeus narrowed on the sides where its posterior margin is raised in the form of a short trenchant ridge or carina as the anterior border of the antennal socket. Frontal carinae rather far apart, usually continued back some distance and often the full length of the head as subparallel ridges forming the inner borders of scrobes or demiscrobes for the accommodation of the antennal scapes. Maxillary palpi 4-jointed; labial palpi 3-jointed. Eyes well developed; ocelli absent. Mandibles rather large, triangular, their apical border with a few large and several small teeth. Premesonotal suture indistinct, mesoepinotal suture more or less distinct; mesoepinotal constriction usually feeble; epinotum with two spines or teeth and episterna usually spined or dentate. Petiole with a short but distinct peduncle and the node large, subcuboidal, rounded above, rarely squamiform; the postpetiole usually broader than the petiole. Legs rather short, middle and hind tibiae with small, simple spurs. Head, thorax, and petiole sculptured, usually rugose or reticulate rugose.

 

Female resembling the worker, but somewhat larger. Pronotum usually very little exposed above; mesonotum and scutellum raised above the level of the pro- and epinotum, the latter with stouter and shorter spines than in the worker. Fore wing with one cubital, one discoidal, and a closed radial cell.

 

Male slightly smaller than the female, with 10-jointed, very exceptionally with 12- or 13-jointed antennae. Second funicular joint very long, representing a fusion of 4 joints. Head small, ocelli and eyes large. Mandibles small but dentate. Pronotum overarched by the mesonotum, which has distinct Mayrian furrows. Epinotum truncate and dentate. Wings as in the female.

 

This genus might be described as peculiar to the Old World, because nearly all the few species occuring in America ( T. caespitum , simillimum , and guineense ) are known to have been introduced by commerce. The group reaches its greatest development in the Ethiopian Region so far as the number of species, subspecies, and varieties is concerned. Arnold has included Triglyphothrix, Xiphomyrmex , and Decamorium as subgenera, but I have treated them as genera, though a few species with simple hairs may be assigned indifferently either to Tetramorium or Triglyphothrix. I have still further reduced the size of the genus Tetramorium by establishing a new genus , Macromischoides , for T. africanum and aculeatum (vide supra). The species of Tetramorium form moderately large colonies and nest in the ground, usually under stones or logs. One of the species, T. caespitum , has a remarkable distribution, ranging from Britain to Japan, around the shores of the Mediterranean, and reappearing at higher elevations on Mt. Kilimanjaro.

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is one native species of Tetramorium in California, T. spinosum (Pergande) , which occurs in open dry habitats of southern California, and one introduced European species, T. caespitum (Linnaeus) (the pavement ant), which is found in urban and agricultural areas of central and northern California. Both are ground-nesting, with generalist foraging habits. Four other non-native species, of tropical origin, have been recorded occasionally from the state.

 

Species identification: keys in Bolton (1979). Additional references: Astruc et al. (2001), Brown (1957d), Bruder and Gupta (1972), Knight and Rust (1990), Longhurst et al. (1980), Martinez (1993), Merickel and Clark (1994), Sanetra and Buschinger (2000), Steiner et al. (2005).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tetramorium Mayr, 1855: Verh. Zool. Bot. Ges. Wien.5: 423.

 

Type-species: Formica caespitum L. ,1758: Syst. Nat., ed.10: 581.

 

Distribution: Palaearctic, Ethiopian, Oriental, Australian, Polynesian, Nearctic & Neotropical regions.

 

Key to species

 

1 Body length 2.5 mm, propodeal spines relatively longer (Fig.42) ....................... ........................... T. brevicorne Brondroit

 

- Body length 3.5 mm, propodeal spines short .......................................................2

 

2- Dorsum of head with a distinct median depression, propodeal spines short and acute (Fig.43)............ T. depressicepes Menozzi

 

- Dorsum of head without a median depression, propodeal armature tuberculate and blunt (Fig.44)............... T. salwaen.sp.

License not applicable

Mohamed, S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Differe seulement du genre Tetramorium proprement dit par ses antennes de 11 articles. Le metanotum est en general plus retreci, arme, sauf chez le X. smithi , de deux longues epines etroites, divergentes, dirigees en arriere et en liant. Chez le genre Tetramorium proprement dit, les epines sont plus courtes et plus verticales; de plus les angles inferieurs de la face declive du metanotum sont ordinairement transformes en dents ou en epines, ce qui n'est pas le cas chez les Xiphomyrmex .

 

A ce sous-genre doivent se rapporter les especes tortuosum Roger , sigmoideum Mayr, smithi Mayr, kellerin. sp. et peut-etre l´ Ochetomyrmex (?) auropunctatus Roger. Mon ami le Dr. Mayr m'ecrit que cette derniere espece ne peut etre rapportee a son genre Ochetomyrmex , a cause de la forme de l'epistome. Cependant a tous les autres egards elle en est bien rapprochee et me parait tout au moins former un passage du sous genre Xiphomyrmex au genre Ochetomyrmex .

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. L. 2,2 a 2,4 mill. Tres semblable aux T. Schaufussii et Nassonowii , mais de taille bien plus petite, et avec le thorax plus robuste, plus large, faiblement convexe, a dos subdeprime et subborde. Le thorax et la tete sont subopaques, tres finement et assez densement reticulesponctues, avec une sculpture superposee mediocrement grossiere, assez faible et vague, reticulee sur le dos du thorax, longitudinalement ridee sur la tete et les cotes du thorax. Metanotum arme de deux dents sensiblement plus longues que chez le T. Nassonowii ou si l'on prefere de deux epines extremement courtes, beaucoup plus courtes que celles du T. Schaufussii . Dents lamelliformes metasternales fort courtes. Suture meso-metanotale comme chez le T. Schaufussii . Premier n oe ud du pedicule comme chez le T. Schaufussii , mais sensiblement plus eleve, plus arrondi au sommet, surtout devant, et encore plus court. Il est plus eleve que le 2 me n oe ud. Pedicule et abdomen lisses et luisants.

 

D'un roux jaunatre. Abdomen d'un brun rousseatre. Pattes et mandibules d'un jaune roussatre.

 

Pilosite et pubescence encore plus faibles que chez le T. Nassonowii. Du reste comme cette espece et comme le T. Schaufussii .

 

Amparafaravantsiv.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ worker ]]. - Long. 3.8 mill. - Mandibules lisses, luisantes, avec de petits points epars, armees de 7 dents, dont les posterieures indistinctes. Epistome sans carene, echancre au milieu de son bord anterieur. Tete comme chez le guineense , mais bien plus large, a peine plus longue que large, distinctement retrecie devant. Massue des antennes plus grele, presque de 4 articles. Thorax, surtout le pronotum, bien plus large que chez le guineense et beaucoup plus convexe dans le sens longitudinal, subborde; echancrure meso-epinotale un peu plus forte. Epines superieures plus verticales, un peu plus courtes-, plus larges a la base, non courbees a l'extremite; dents inferieures plutot plus courtes N oe uds du pedicule plus epais, plus larges et plus arrondis que chez le guineense- Le premier n oe ud n'est pas tronque, mais arrondi devant, et forme avec son petiole anterieur une seule courbe anterieure concave sur le profil; il est aussi arrondi et bien moins tronque derriere.

 

Meme sculpture que. le guineense , mais plus serree, ' un peu plus.

 

fine et moins luisante; base de l'abdomen striee en long. Pilosite comme chez le guineense .

 

D'un rouge brunatre, comme la Myrmica laevinodis ; membres plus clairs; abdomen un peu plus terne, plus brun jaunatre; donc plus fonce que le guineense , sauf l'abdomen qui est au contraire plus clair.

 

Natal (Haviland). Tres voisin du guineense et pourtant nettement different; plus grand, plus robuste, avec les mandibules lisses, les epines differentes, ainsi que le 1 er n oe ud, etc. Etant donnee la grande constance du guineense , je suis d'avis qu'il s'agit d'une espece distincte. Autant que la description permet d'en juger, il differe de quadridentatum Stitz par ses courtes dents inferieures (episternales), par les mandibules lisses et par l'epistome echancre.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Se distingue des autres especes des Xiphomyrmex et des Rogeria par son enorme tete, par son exiguite, par son habitat nearctique et par ses teguments lisses.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Tetramorium sp. nov 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium sp. PK_TETR 015

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium ARA02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium bessonii_ARA01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium ARA10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium ARA04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium ARA03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MY04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MY12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium AFRC-NAM-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG150

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG128

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG151

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG146

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG125

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG137

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG127

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG126

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium beanka_m03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG141

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG118

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG110

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG122

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG109

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG123

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG124

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG111

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG090

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG049

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG059

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG041

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG060

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG075

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG039

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG055

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG050

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG058

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG074

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG108

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG042

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG038

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG062

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG035

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG046

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG064

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG101

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG040

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG036

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG076

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG047

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG044

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG072

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG094

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG097

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG083

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG037

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG052

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG056

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG104

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG071

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG057

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG095

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG073

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG103

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG121

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG063

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG029

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG016

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG031

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG024

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG027

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium caespitum_cf

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium caespitum_group_NA

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Tetramorium cf. caespitum FMS-2004

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATCCCCCATTAGCATCTAATATCTTTCATAGAGGCCCATCAATTGATCTATCAATTTTTTCTCTTCATATTGCAGGAATATCTTCTATTATAGGTGCAATTAATTTTATCGCTACTATTATAAACATACATCATAAAAAATTAACCTTAGATAAAATCCCCCTGTTAGTTTGATCTATTTTAATTACAGCAATTCTTCTCCTCCTATCTCTTCCCGTATTAGCAGGAGCTATTACTATACTCTTAACAGATCGTAATTTAAATACCTCATTTTTTGATCCATCAGGTGGGGGGGACCCAATTCTATATCAACATTTATTCTGATTTTTTGGACACCCAGAAGTATATATCTTAATTTTACCAGGATTTGGTTTAATTTCCCATATTATTATAAATGAAAGAGGAAAAAAAGAAACATTTGGATCACTTGGAATAATTTATGCTATAATAGCTATTGGATTCTTAGGATTTATTGTATGAGCTCATCATATATTTACTGTAGGAATAGATGTAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium cf. caespitum FMS-2004

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG02_delagoense_n

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tetramorium MG01_delagoense_n

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 4669
Specimens with Sequences: 3163
Specimens with Barcodes: 2725
Species: 416
Species With Barcodes: 249
Public Records: 326
Public Species: 36
Public BINs: 40
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tetramorium

Tetramorium ant tending a mealy bug

Tetramorium is a genus of ants in the subfamily Myrmicinae that includes more than 520 species.[1][2]

Tetramorium was first described in the same publication as Monomorium.[3]

Description[edit]

Workers are around two to four millimeters long. Males have antennae with eleven segments.[citation needed]

Distribution[edit]

Most species are distributed throughout the Afrotropical and Oriental regions. Ten species have been recorded from Japan. T. caespitum is native to Europe, but was introduced to North America in the 18th century.[citation needed]

Species[edit]

References[edit]

  1. ^ Bolton, B. (2014). "Tetramorium". AntCat. Retrieved 3 July 2014. 
  2. ^ a b Sharaf, Aldawood, Taylor (2012). "A New Ant Species of the Genus Tetramorium Mayr, 1855 (Hymenoptera: Formicidae) from Saudi Arabia, with a Revised Key to the Arabian Species". PLOS ONE 7 (2): e30811. doi:10.1371/journal.pone.0030811. 
  3. ^ Mayr, G. (1855): Formicina austriaca. Beschreibung der bisher im österreichischen Kaiserstaate aufgefundenen Ameisen nebst Hinzufügung jener in Deutschland, in der Schweiz und in Italien vorkommenden Ameisen. Verhandlungen des Zoologisch-Botanischen Vereins in Wien 5: 273-478.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!