Overview
Brief Summary
The species is highly esteemed as food. It is fished by deep-sea trawlers off N.W. Africa and along the Mediterranean coasts of Spain, France, Italy and Malta. It is also taken by Israel trawlers, but less commonly so than Aristaeomorpha foliacea, while in the Western Mediterranean the opposite is true.
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
Trusted
Distribution
Adriatic Sea, Aegean Sea, Alboran Sea, Azores, Balear Sea, Cape Verde, Coast of Algeria, East Atlantic, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, France, Greece, Greek Exclusive Economic Zone, Guinea Bissau Exclusive Economic Zone, Gulf of Gascogne, Indian Ocean, Ionian sea, Israel, Israeli part of the Mediterranean Sea - Eastern Basin, Italy, Japan, Levantine Basin, Madagascar, Maldives, Malta, Mediterranean Sea, Moroccan Atlantic, Moroccan Exclusive Economic Zone, Morocco, Mozambique, Natal, North Mediterranean, Portugal, Reunion, Réunion Exclusive Economic Zone, Sahara Coast, South Africa (country), South East Atlantic, South Portugal, South West England, Spain, Tanzania, Tunisia, West Portugal, Western Sahara, Zanzibar
-
Crosnier, A. (1985). Crevettes pénéides récoltées dans l'océan Indien lors des campagnes Benthedi, Safari I et II, MD 32/Réunion. Bull. Mus. Natn. Hist. nat., Paris vol. 4, ser. 7 p. 839-877.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6057
-
Alvarez R.Z. (1968). Crustaceos Decapodos Ibericos. Investigacion Pesquera, 32, 1-499.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10189
-
L. B. Holthuis & E. Gottlies(1958) An annotated list of Decapod Crustacea of the Mediterranean Coast of Israel, with an appendix listing the Decapoda of the Eastern Mediterranean. Bulletin of the Research Council of Israel. Haifa, Israel. 1-126pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42367
-
Charles H.J.M. Fransen
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42308
-
Dore I. & Frimodt C. (1987). An Illustrated Guide to Shrimp of the World. Van Nostrand Reinhold Company,, New York, 1-229.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=21395
-
Burukovskii, R.N.(1998). On the distribution of shrimp in West African waters.Russian Journal of Zoology, Vol. 2,No.3,pp 400-408.Translated from Zoologicheskii Zhurnal, vol.77, No. 7 1998,pp 778-787
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42371
-
d'Udekem d'Acoz, C. (1999). Inventaire et distribution des crustacés décapodes de l'Atlantique nord-oriental, de la Méditerranée et des eaux continentales adjacentes au nord de 25°N [Inventory and distribution of the decapod crustaceans from the northeastern Atlantic, the Mediterranean and the adjacent continental waters north of 25°N]. Collection Patrimoines Naturels, 40. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-86515-114-10. X, 383 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1154
-
Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284-292
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1392
-
Poupin, J., 2010. - Biodiversité de l’Indo-Pacifique tropical français : 2514 espèces de crustacés décapodes et stomatopodes. Rapport scientifique de l'Institut de Recherche de l'Ecole Navale, Octobre 2010, 76 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=147708
-
Galil, B.; Goren, M.; Mienis, H. (2011). Checklist of marine species in Israel. Compiled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149096
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Pérez Farfante, I. & B. Kensley, 1997. Penaeoid and sergestoid shrimps and prawns of the world. Keys and diagnoses for the families and genera.— Mémoires du Muséum National d’Histoire naturelle 175: 1-233.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=47741
-
Muñoz, Isabel; García-Isarch, Eva; Sobrino, Ignacio; Burgos, Candelaria; Funny, Rita; González-Porto, Marcos. (2012). Distribution, abundance and assemblages of decapod crustaceans in waters off Guinea-Bissau (north-west Africa). Journal of the Marine Biological Association of the United Kingdom, vol. 92 issue 3, p. 475-494.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=166087
-
Lioris, D., Rucabado, J. 1998. Guide d'identification des Ressources Marines Vivantes du Maroc. Guide FAO d'identification des espèces pour les besoins de la pêche. Organisation des Nations Unies pour l'Alimentation et l'Agriculture : 263pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164103
-
Nouar, A., H. Kennouche, N. Ainouche & J.E. Cartes. 2011. Temporal changes in the diet of deep-water penaeoidean shrimp (Parapenaeus longirostris and Aristeus antennatus) off Algeria (southwestern Mediterranean). Scientia Marina 75(2):279-288.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=153120
Trusted
Distribution: also known from the Mediterranean and East Atlantic
-
Fischer, W. & G. Bianchi (Eds.) (1984). FAO Species identification sheets For Fisheries Purposes: Western Indian Ocean. FAO, Rome.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5930
Trusted
Eastern Atlantic: Portugal to the Cape Verde Islands; entire Mediterranean.
Trusted
Physical Description
Size
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 64 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 173 - 80000
Temperature range (°C): 3.232 - 16.422
Nitrate (umol/L): 0.972 - 23.734
Salinity (PPS): 34.787 - 38.663
Oxygen (ml/l): 3.932 - 6.238
Phosphate (umol/l): 0.132 - 1.894
Silicate (umol/l): 3.166 - 17.236
Graphical representation
Depth range (m): 173 - 80000
Temperature range (°C): 3.232 - 16.422
Nitrate (umol/L): 0.972 - 23.734
Salinity (PPS): 34.787 - 38.663
Oxygen (ml/l): 3.932 - 6.238
Phosphate (umol/l): 0.132 - 1.894
Silicate (umol/l): 3.166 - 17.236
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 173 - 80000
Temperature range (°C): 3.232 - 16.422
Nitrate (umol/L): 0.972 - 23.734
Salinity (PPS): 34.787 - 38.663
Oxygen (ml/l): 3.932 - 6.238
Phosphate (umol/l): 0.132 - 1.894
Silicate (umol/l): 3.166 - 17.236
Graphical representation
Depth range (m): 173 - 80000
Temperature range (°C): 3.232 - 16.422
Nitrate (umol/L): 0.972 - 23.734
Salinity (PPS): 34.787 - 38.663
Oxygen (ml/l): 3.932 - 6.238
Phosphate (umol/l): 0.132 - 1.894
Silicate (umol/l): 3.166 - 17.236
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Aristeus antennatus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CAGCCCTAAGATTAATTATTCGAGCTGAATTAGGACAACCAGGAAGATTAATTGGAGATGACCAAATTTATAATGTTATTGTGACCGCTCATGCTTTCGTAATGATTTTCTTTATAGTTATGCCTATTATAATTGGAGGGTTCGGGAATTGATTAGTACCCCTAATACTTGGGGCCCCAGATATGGCTTTTCCACGTATAAACAATATGAGTTTTTGGCTTTTACCTCCCTCTTTAACCCTACTCCTTTCTAGAGGAATGGTAGAAAGAGGAGTGGGTACAGGATGAACTGTTTACCCTCCTCTATCTGCTAGCATCGCTCATGCGGGTGCTTCTGTAGACATAGGAATTTTCTCACTTCATTTAGCCGGGGTTTCTTCAATTTTAGGAGCCGTTAATTTTATAACTACTGTTATTAATATACGAAGAACTGGAATAACTATAGACCGAATTCCTCTTTTTGTTTGATCTGTTTTTATTACCGCCCTACTTCTTCTTCTTTCATTACCTGTCCTAGCAGGAGCTATTACCATACTTCTAACAGATCGAAATTTAAATACCTCTTTCTTTGACCCCGCAGGTGGTGGGGACCCAGTCCTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Aristeus antennatus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Relevance to Humans and Ecosystems
Benefits
The species is highly esteemed as food. It is fished by deep-sea trawlers off N.W. Africa and along the Mediterranean coasts of Spain, France, Italy and Malta. It is also taken by Israel trawlers, but less commonly so than Aristaeomorpha foliacea, while in the Western Mediterranean the opposite is true.
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

