Overview

Brief Summary

The species is highly esteemed as food. It is fished by deep-sea trawlers off N.W. Africa and along the Mediterranean coasts of Spain, France, Italy and Malta. It is also taken by Israel trawlers, but less commonly so than Aristaeomorpha foliacea, while in the Western Mediterranean the opposite is true.
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Food and Agriculture Organization of the United Nations

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Adriatic Sea, Aegean Sea, Alboran Sea, Azores, Balear Sea, Cape Verde, Coast of Algeria, East Atlantic, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, France, Greece, Greek Exclusive Economic Zone, Guinea Bissau Exclusive Economic Zone, Gulf of Gascogne, Indian Ocean, Ionian sea, Israel, Israeli part of the Mediterranean Sea - Eastern Basin, Italy, Japan, Levantine Basin, Madagascar, Maldives, Malta, Mediterranean Sea, Moroccan Atlantic, Moroccan Exclusive Economic Zone, Morocco, Mozambique, Natal, North Mediterranean, Portugal, Reunion, Réunion Exclusive Economic Zone, Sahara Coast, South Africa (country), South East Atlantic, South Portugal, South West England, Spain, Tanzania, Tunisia, West Portugal, Western Sahara, Zanzibar
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution: also known from the Mediterranean and East Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Portugal to the Cape Verde Islands; entire Mediterranean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Food and Agriculture Organization of the United Nations

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum total length 220 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Food and Agriculture Organization of the United Nations

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 64 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 173 - 80000
  Temperature range (°C): 3.232 - 16.422
  Nitrate (umol/L): 0.972 - 23.734
  Salinity (PPS): 34.787 - 38.663
  Oxygen (ml/l): 3.932 - 6.238
  Phosphate (umol/l): 0.132 - 1.894
  Silicate (umol/l): 3.166 - 17.236

Graphical representation

Depth range (m): 173 - 80000

Temperature range (°C): 3.232 - 16.422

Nitrate (umol/L): 0.972 - 23.734

Salinity (PPS): 34.787 - 38.663

Oxygen (ml/l): 3.932 - 6.238

Phosphate (umol/l): 0.132 - 1.894

Silicate (umol/l): 3.166 - 17.236
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aristeus antennatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CAGCCCTAAGATTAATTATTCGAGCTGAATTAGGACAACCAGGAAGATTAATTGGAGATGACCAAATTTATAATGTTATTGTGACCGCTCATGCTTTCGTAATGATTTTCTTTATAGTTATGCCTATTATAATTGGAGGGTTCGGGAATTGATTAGTACCCCTAATACTTGGGGCCCCAGATATGGCTTTTCCACGTATAAACAATATGAGTTTTTGGCTTTTACCTCCCTCTTTAACCCTACTCCTTTCTAGAGGAATGGTAGAAAGAGGAGTGGGTACAGGATGAACTGTTTACCCTCCTCTATCTGCTAGCATCGCTCATGCGGGTGCTTCTGTAGACATAGGAATTTTCTCACTTCATTTAGCCGGGGTTTCTTCAATTTTAGGAGCCGTTAATTTTATAACTACTGTTATTAATATACGAAGAACTGGAATAACTATAGACCGAATTCCTCTTTTTGTTTGATCTGTTTTTATTACCGCCCTACTTCTTCTTCTTTCATTACCTGTCCTAGCAGGAGCTATTACCATACTTCTAACAGATCGAAATTTAAATACCTCTTTCTTTGACCCCGCAGGTGGTGGGGACCCAGTCCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aristeus antennatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The species is highly esteemed as food. It is fished by deep-sea trawlers off N.W. Africa and along the Mediterranean coasts of Spain, France, Italy and Malta. It is also taken by Israel trawlers, but less commonly so than Aristaeomorpha foliacea, while in the Western Mediterranean the opposite is true.
The species is sold fresh.The total catch reported for this species to FAO for 1999 was 2 629 t. The countries with the largest catches were Tunisia (1 335 t) and Algeria (880 t).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Food and Agriculture Organization of the United Nations

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!