Articles on this page are available in 1 other language: Arabic (8) (learn more)

Overview

Distribution

Guiana shield and Amazon basin of Colombia, Ecuador, Brazil, Peru, Bolivia

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Larsen, Trond

Source: Scarabaeinae dung beetles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Dry weight (biomass)

53 to 197, mean 137 mg

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Larsen, Trond

Source: Scarabaeinae dung beetles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body length

11 to 19, mean 14.7 mm

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Larsen, Trond

Source: Scarabaeinae dung beetles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Widespread and uncommon to fairly common in terra firme forest; less abundant in floodplain forest, gallery forest, dry forest, scrub, second growth and bamboo up to 1000 m

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Larsen, Trond

Source: Scarabaeinae dung beetles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Dung, less often to carrion

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Larsen, Trond

Source: Scarabaeinae dung beetles

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phanaeus chalcomelas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTGATTAGTTCCTTTAATA---TTAGGAGCACCTGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGACTTCTACCACCTTCATTAACTTTATTATTAATAAGTAGAATAGTAGAAAATGGAGCTGGAACAGGATGAACAGTATACCCTCCTTTATCAGCAAATATAGCCCATAGAGGCGCTTCAGTAGATTTA---GCTATTTTTAGATTACATTTAGCTGGAATCTCATCAATTTTAGGTGCAATTAATTTTATTACTACTGTAATTAATATACGATCTACAGGTATAACTTTTGATCGTATACCTTTATTTGCTTGAGCAGTAGCCCTTACAGCCCTACTACTATTATTATCTTTACCTGTATTAGCCGGA---GCAATTACTATACTTCTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGTAGGAGGAGGTGACCCTATTCTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phanaeus chalcomelas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!