Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Red Squirrels are very vocal. They bark at intruders, including humans, and can bark continuously for more than an hour if they are annoyed. They also chatter, especially to stake out a territory and protect their stored food supply (conifer cones, which they harvest in great numbers) from other squirrels. They are especially noisy during the breeding season, when they chase each other through tree branches making a distinctive call that sounds almost like the buzz of cicadas. They readily nest in attics and cabins, and are trapped for their fur.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Erxleben, J.C.P., 1777.  Systema regni animalis per classes, ordines, genera, species, varietas, cum synonymia et historia animalium.  Classis I, Mammalia, p. 416.  Wegand, Leipzig, 636 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Biogeographic Regions: nearctic (Native )

  • McAdam, A., S. Boutin, A. Sykes, M. Humphries. 2007. Life histories of red squirrels and their contributions to population growth and lifetime fitness. Ecoscience, 14: 362-369.
  • Steele, M. 1998. Mammalian Species. Pp. 1-9 in Tamiasciurus hudsonicus, Vol. 586. American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges widely in northern North America. It occurs from Alaska in the United States, eastward across Canada and southward to Arizona and New Mexico (in the west) and to extreme northern Georgia (in the east) in the United States. It is introduced to Newfoundland in eastern Canada.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Alaska to Newfoundland, south to the southern Appalachians and through the Rocky Mountains to Arizona and New Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Red squirrels are native to the Nearctic region and have one of the widest distributions of all North American squirrels. They are found from Alaska continuously across Canada to the northeast United States and south through the Appalachian states. They also occur throughout the Rocky Mountains.

Biogeographic Regions: nearctic (Native )

  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington [D.C.]: Smithsonian Institution Press in association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The range of the red squirrel extends from Quebec and Ontario west to
Alaska; south in the Appalachian Mountains to Tennessee; and south in
the Rocky Mountains to New Mexico [6].
  • 6. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AK AZ CO CT DE ID IL IN IA KY
ME MD MA MI MN MT NH NJ NM NY
NC ND OH OR PA RI SC SD TN UT
VT VA WA WV WI WY
AB BC MB NB NF NT ON PQ SK YT

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Red squirrels differ from other tree squirrels by their deep reddish color, territorial behavior, and their smaller body size. They are less than 30% the size of grey squirrels (Sciurus carolinensis). While size and pelage color can vary geographically, they generally have a reddish back and white underside that is demarcated by dark lateral lines, which are especially visible in summer. A white eye ring is present year-round and tufted ears are during the winter. Variation in the dorsal surface color can range from reddish to ferruginous brown to olivaceous gray, usually with a distinctive reddish or brownish lateral band running down the back. The tail is smaller and flatter than that of other tree squirrels and varies in color from yellowish-gray to rusty red, with a band of black often extending the entire length of tail. Where its range borders that of Douglas squirrels (Tamiasciurus douglasii), red squirrels are distinguished by color of their pelage. The underside of red squirrels is all white or cream, whereas Douglas squirrels are rust colored or with a blackish wash. Tail hairs have yellowish to rusty tips with a black band in red squirrels, whereas those of Douglas squirrels are white-tipped with a black band, making them moderately easy to distinguish from a distance. Male and female red squirrels are very similar in appearance.

Some ecogeographic variation is believed to occur, so length and weight measurements may only hold true for the population(s) in which they were measured. Twenty-five subspecies of red squirrels are recognized. They differ mainly by range distribution. Mass tends to range from 197.3 to 282.2 g, with an average of 212.97. Their total length ranges from 270 to 385 mm, with an average of 327.5. Much of their length is their tail, which is 92 to 158 mm long. Red squirrels have an average hind foot length of 35 to 57 mm and the ear length is 19 to 31 m. Condylobasal length is 42 to 50 mm. Red squirrels have a basal metabolic rate of 166 cm^3 oxygen/hour.

Red squirrels generally experience two annual molts, although the tail molts only once per year. The spring molt occurs from late March through August and starts on the nose and front feet, and ends on the rump. The fall molt is from late August to early December and begins on the tail and then progresses to the rump and the head before ending on the legs and flank. Molt stage can be an important age indicator. Skulls can be aged by looking at dental characteristics such as visible wear and presence of permanent teeth. Their dental formula is I 1/1, C 0/0, P 1/1 or 2/1, M 3/3. The total number of teeth is 20 or 22 depending on the presence of upper P3.

Range mass: 197.3 to 282.2 g.

Average mass: 212.97 g.

Range length: 270 to 385 mm.

Average basal metabolic rate: 166 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 1.615 W.

  • Flyger, V., J. Gates. 1982. Pine Squirrels: Tamiasciurus hudsonicus, T. douglasii. Pp. 230-237 in J Chapman, G Feldhamer, eds. Wild mammals of North America. Baltimore: John Hopkins University Press.
  • Hall, E. 1981. Red Squirrel, Tamiasciurus hudsonicus. The Mammals of North America. Ronald Press.
  • Kramm, K., D. Maki, J. Glime. 1975. Variation within and among populations of red squirrel in the Lake Superior Region. Journal of Mammalogy, 56/1: 258-262. Accessed October 14, 2011 at http://www.jstor.org/stable/1379633.
  • Lane, J., S. Boutin, J. Speakman, M. Humphries. 2010. Energetic costs of male reproduction in a scramble competition mating system. Journal of Animal Ecology, 79: 27-34.
  • Layne, J. 1952. The Os Genitale of the red squirrel, Tamiasciurus. Journal of Mammalogy, 33/4: 457-459.
  • Lindsay, S. 1982. Systematic relationship of parapatric tree squirrel species (Tamiasciurus) in the Pacific Northwest. Canadian Journal of Zoology, 60/9: 2149-2156.
  • Nellis, C. 1969. Sex and age variation in red squirrel skulls from Missoula County, Montana. The Canadian Field Naturalist, 83: 324-330.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Red squirrels have a total body length of from 280 to 350 mm, with the tail making up from 95 to 150 mm of that. Fur color is highly variable. Red squirrels in different part of their range can look quite different. Color changes between summer and winter as well. The fur on their back is usually brownish or olive-red in color. During the summer, a black stripe runs along their side, between the fur color of their back and their belly. The belly is white or cream color. The tail is often edged with white. There are white bands encircling their large, black eyes. The tail is not as thick or bushy as other North American tree squirrels. They are well adapted for climbing and running through the trees with compact, muscled bodies, strong claws, and powerful hind limbs.

Red squirrels might be confused with the young of Sciurus niger and Sciurus carolinensis. Red squirrels have a distinct white eye ring, which the other squirrel species lack. They are also distinguished by their extreme speed and agility, they zip around on trees and bushes, often while chattering loudly. The difference between the grey/red fur on their back and the white fur on their belly is often very distinct, another difference between these squirrels and other Sciurus species.

Range mass: 140 to 250 g.

Average mass: 194.5 g.

Range length: 280 to 350 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 1.615 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 39 cm

Weight: 252 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: 280-350 mm

Weight:
Range: 140-250 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Red squirrels occupy northern boreal coniferous forests abundant with conifer seeds, fungi, and interlocking canopies. This limits them to mountain ranges on the southern and eastern boundaries of their range. In the Rocky Mountains they have been found at elevations up to 2,500 ft (762 m). Populations of red squirrels occur in different habit conditions due to the vastness of their range. They occur in both temperate and polar environments and are considered to be primarily arboreal. They can be found in a mixed variety of forests including coniferous, deciduous, and mixed forests and they are also able to thrive in suburban and urban settings, as long as cool, coniferous forests with dense, interlocking canopies and abundant fungal resources are present.

Range elevation: 0 to 762 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest ; mountains

Other Habitat Features: urban ; suburban ; riparian

  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington (D.C.): Smithsonian Institution Press in association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It prefers coniferous and mixed forests, but also occurs in deciduous woodlands, hedgerows, and second-growth areas. It prefers to nest in tree cavities; and also constructs leaf nests and uses ground burrows.

It breeds March-April and June-July in Quebec. Gestation lasts 31-35 days. Some females produce two litters per year; litter size averages 4-5. Some females breed when less than one year old (Lair 1986).

This species is more territorial than most other North American tree squirrels. Some populations in British Columbia are limited by food (acting through effect on reproduction) (Sullivan 1990); but factors such as territorial behaviour may limit populations at high density (Klenner and Krebs 1991).

Diet consists of seeds, conifer cones, nuts, fruits. It occasionally feeds on invertebrates and small vertebrates. Commonly caches, and later consumes, large amounts of food. Usually quite conspicuous throughout the day. Most active two hours after sunrise and before sunset.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Prefers coniferous and mixed forests, but also occurs in deciduous woodlots, hedgerows, second-growth areas. Prefers to nest in tree cavities; also constructs leaf nests and uses ground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red squirrels are found in a variety of forested habitats, including coniferous, deciduous, and mixed forests. They can be found in suburban settings where there are large stands of mature trees.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, natural, tree

Nesting: Red squirrels prefer natural cavities or abandoned woodpecker
holes for nesting. When these are not available a leaf or grass nest is
constructed near the top of a tree with dense foliage. Occasionally red
squirrels use abandoned burrows of other species [6]. Nest trees in
Arizona have crowns that interlock with two or more adjacent trees, and
average 14 inches (35.6 cm) d.b.h. [47]. In New York leaf nests are
built in deciduous trees and pines. Trees used for leaf nests ranged
from 4 to 16 inches (10.2-40.6 cm) in diameter, were 15 to 70 feet
(4.5-21.3 m) tall, and the nests were 12 to 60 feet (3.7-18.3 m) above
the ground. Cavity trees ranged from 12 to 36 inches (30.5-91.4 cm) in
diameter and were 20 to 60 feet (6-18.3 m) tall; entrance holes were 7 to
50 feet (2.1-15 m) above the ground [25].

Shelter: Nest cavities are sometimes used by one to several red
squirrels in severe weather [25]. In winter red squirrels tunnel in
deep snow to find food and escape severe weather [3,13].

Cone-bearing Trees and Food Cache Sites: Red squirrels in Arizona
require 9 to 25 large, mature, cone-bearing trees (or a larger number of
smaller cone-bearing trees) per territory [27,47]. Red squirrels use
moist, shaded areas for the central food cache. These areas are created
by groups of mature trees with some understory vegetation nearby. Large
trees in a group closely spaced in 0.1 acre (0.04 ha) or less are
favored. Canopy cover at 90 percent of cache sites is greater than 60
percent. One or more large snags, fallen logs, or live trees act as
support structures for the cache [47].

In Pennsylvania primary red squirrel feeding sites (not caches) were
associated with burrow entrances, overstory cone-bearing pines, and
other primary feeding sites. They tended to be away from nest trees [50].
  • 3. Brink, C. Holden; Dean, Frederick C. 1966. Spruce seed as a food of red squirrels and flying squirrels in interior Alaska. Journal of Wildlife Management. 30(3): 503-512. [13253]
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 27. Patton, David R.; Vahle, J. Robert. 1986. Cache and nest characteristics of the red squirrel in an Arizona mixed-conifer forest. Western Journal of Applied Forestry. 1(2): 48-51. [25249]
  • 47. Vahle, J. Robert, Patton, David R. 1983. Red squirrel cover requirements in Arizona mixed conifer forests. Journal of Forestry. 81: 14-15, 22. [25259]
  • 50. Yahner, Richard H. 1987. Feeding-site use by red squirrels, Tamiasciurus hudsonicus, in a marginal habitat in Pennsylvania. The Canadian-Field Naturalist. 101: 586-589. [25257]
  • 6. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the term: density

Red squirrels require mature coniferous trees as a source of cones and
seed [6]. The best cone production occurs in 200- to 300-year old
Douglas-fir, 40- to 300-year old white fir, and 150- to 200-year-old
Engelmann spruce. The best seed-producing stands of blue spruce (Picea
pungens) are 50 to 150 years old [31]. In central Colorado red
squirrels were present in closed stands of mature conifers [36]. In
west-central Colorado red squirrel caches were more abundant in
conifer-dominated stands than in mixed stands or in stands dominated by
quaking aspen [35]. In Ontario red squirrel tracks were more abundant
in uncut forest than in regenerating stands of various ages with brushy
understories [44].

In two study sites in central British Columbia red squirrels were twice
and over five times as abundant in unthinned stands of 20-year-old
lodgepole pine than in thinned stands. They were most abundant in
mature stands. It was suggested that the 20-year-old stands represented
marginal habitat that served as a sink area for excess juvenile red
squirrels [41].

Home Range: Red squirrel home range size varies with sex, age, and
habitat quality. Older red squirrels and females tend to have larger
home ranges. In lodgepole pine forests home ranges varied in size from
0.7 to 2.0 acres (0.3-0.8 ha); in mixed hardwood-conifer stands home
ranges varied from 6.5 to 11 acres (2.6-4.5 ha) [31]. Home ranges of
adult males in New York averaged 6.03 acres (2.4 ha) and ranged from
0.47 to 10.76 acres (0.2-4.3 ha) [25]. Davis [5] reported home ranges
of 3.2 acres (1.3 ha) for males and 3.7 acres (1.5 ha) for females.
Obbard [53] summarized other data on red squirrel home ranges.

Territoriality and Population Density: Red squirrels actively defend a
territory [18]. Gurnell [15] estimated that defended territories were
60 to 100 percent of the home range in lodgepole pine forests. In
British Columbia spruce-fir and hemlock-cedar (Thuja spp.) forests adult
territories averaged 2.2 acres (0.9 ha) at low elevations and 1.3 acres
(0.5 ha) at high elevations [52]. There are two types of defended
areas: most if not all red squirrels in Alberta defend a winter food
cache, which is usually abandoned during the summer, and some red
squirrels defend a "prime" territory which has an adequate food supply
year-round. One-quarter to one-third of adults defend a prime territory
[19]. In New Brunswick, where red squirrels are scatterhoarders instead
of larderhoarders, territories encompassing the entire food supply are
defended from conspecifics [7]. Smith [52] reported that defended red
squirrel territories in coniferous forests ranged from 0.5 to 3 acres
(0.2-1.2 ha).

Davis [5] reported red squirrel population density of 4 squirrels per 25
acres in mixed jack pine-black spruce stands and 23 red squirrels per 25
acres in white spruce forest. In southwestern Yukon Territory red
squirrel population densities of 27 per 25 acres (10 ha) and 17 per 25
acres were observed in white spruce forest interspersed with willow
(Salix spp.)-dominated meadows [29].

Many studies, reviewed by Klenner and Krebs [22], indicated that red
squirrel population density varies with cone crops. Zasada and others
[51] also suggested a relationship between red squirrel density and the
periodicity of white spruce cone production in Alaska since red
squirrels are dependent on white spruce cones for the majority of their
food. Rusch and Reeder [34] reported that summer populations fluctuated
between 67 and 151 red squirrels per 2,500 acres in mixed habitats.
Sullivan [40] reported that red squirrel population density in British
Columbia increased with food supplementation indicating that food
availability was limiting population density. In south-central British
Columbia food supplementation (feeders that were kept full of sunflower
[Helianthus spp.] seeds) in Douglas-fir and in white spruce forests
resulted in increases in red squirrel population densities. The amount
of change was greatest in the population occupying the Douglas-fir
stands, a low density population. Recruitment rates were very high
initially, but decreased with increasing population density. Each
population increased to approximately the same density, suggesting that
the factor regulating the maximum population density is not food supply
but territoriality. When feeders were removed, population density
declined to control levels in about 6 months [22].
  • 5. Davis, Donald Wayne. 1969. The behavior and population dynamics of the red squirrel (Tamiasciurus hudsonicus) in Saskatchewan. Fayetteville, AR: University of Arkansas. 229 p. Dissertation. In: Dissertation Abstracts. 30: 902 B. [Abstract]
  • 7. Dempsey, Jeffrey A.; Keppie, Daniel M. 1993. Foraging patterns of eastern red squirrels. Journal of Mammalogy. 74(4): 1007-1013. [22613]
  • 15. Gurnell, John. 1984. Home range, territor., caching beh. & food supply of the red squirrel (Tamiasciurus hudsonicus fremonti) in a subalpine lodgepole pine forest. Animal Behaviour. 32(4): 1119-1131. [25358]
  • 18. Hutchins, Harry E. 1994. Role of various animals in dispersal and establishment of whitebark pine in the Rocky Mountains, U.S.A. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 163-171. [24638]
  • 19. Kemp, Gerald A.; Keith, Lloyd B. 1970. Dynamics and regulation of red squirrel (Tamiasciurus hudsonicus) populations. Ecology. 51(5): 763-779. [25260]
  • 22. Klenner, Walt; Krebs, Charles J. 1991. Red squirrel population dynamics. I. The effect of supplemental food on demography. Journal of Animal Ecology. 60: 961-978. [25248]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 29. Price, Karen. 1994. Center-edge effect in red squirrels: evidence from playback experiments. Journal of Mammalogy. 75(2): 545-548. [25251]
  • 31. Reynolds, Richard T.; Graham, Russell T.; Reiser, M. Hildegard; [and others]
  • 34. Rusch, Doris A.; Reeder, William G. 1978. Population ecology of Alberta red squirrels. Ecology. 59(2): 400-420. [25252]
  • 35. Scott, Virgil E.; Crouch, Glenn L. 1988. Summer birds and mammals of aspen-conifer forests in west-central Colorado. Res. Pap. RM-280. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 6 p. [13254]
  • 36. Scott, Virgil E.; Crouch, Glenn L.; Whelan, Jill A. 1982. Responses of birds and small mammals to clearcutting in a subalpine forest in central Colorado. Res. Note RM-422. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 6 p. [4494]
  • 40. Sullivan, Thomas P. 1990. Responses of red squirrel (Tamiasciurus hudsonicus) populations to supplemental food. Journal of Mammalogy. 71(4): 579-590. [25254]
  • 41. Sullivan, Thomas P.; Moses, Richard A. 1986. Red squirrel populations in natural and managed stands of lodgepole pine. Journal of Wildlife Management. 50(4): 595-601. [25255]
  • 44. Thompson, I. D.; Davidson, I. J.; O'Donnell, S.; Brazeau, F. 1989. Use of track transects to measure the relative occurrence of some boreal mammals in uncut forest and regeneration stands. Canadian Journal of Zoology. 67: 1816-1823. [25256]
  • 51. Zasada, John C.; Van Cleve, Keith; Werner, Richard A.; [and others]
  • 52. Smith, Christopher C. 1968. The adaptive nature of social organization in the genus of three squirrels Tamiasciurus. Ecological Monographs. 38(1): 31-63. [25258]
  • 53. Obbard, Martyn E. 1987. Red squirrel. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Mallock, A. M., eds. Wild furbearer management and conservation in North America. 264-281. [25262]
  • 6. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: competition, hardwood

The red squirrel inhabits coniferous forests, mixed conifer-hardwood and
occasionally hardwood forests, and rural woodlots [6,19,13].

In western North America red squirrels occur in white spruce (Picea
glauca) and black spruce (P. mariana) stands [13,34], Douglas-fir
(Pseudotsuga menziesii) forests [22] and pine (Pinus spp.) forests [41].

In Alberta red squirrels occur in quaking aspen (Populus
tremuloides)-balsam poplar (P. balsamea) stands with scattered white
spruce and black spruce [19]. They also occupy habitats dominated by
jack pine (Pinus banksiana) with occasional stands of white spruce.
Tamarack (Larix laricina) bogs and black spruce bogs are usually
occupied only for periods by juvenile red squirrels searching for
suitable territories [13,24].

In Wyoming red squirrels are present in continuous whitebark pine (P.
albicaulis), Engelmann spruce (Picea engelmannii)-subalpine fir (Abies
lasiocarpa), and lodgepole pine (Pinus contorta) forests [18].

In Colorado red squirrels favor lodgepole pine forests over open stands
of ponderosa pine (P. ponderosa) [13]. They are also found in
Douglas-fir and in stands transitional between Douglas-fir and ponderosa
pine. Their absence from ponderosa pine stands may be a result of
interspecific competition with Abert's squirrels (Sciurus aberti).
Outside the range of Abert's squirrel, red squirrels are more common in
ponderosa pine stands (i.e., in Black Hills National Forest, South
Dakota, and Medicine Bow National Forest, Wyoming) [11].

In Arizona and Utah red squirrels prefer fir and spruce forests and are
more rarely found in ponderosa pine forests [13]. They are closely
associated with old-growth Douglas-fir, white fir (A. concolor), and
blue spruce (Picea pungens) stands [27]. Red squirrels are common in
low-elevation mixed species forests in central Arizona [46].

In eastern North America red squirrels are abundant in mature hardwood
forests containing some mature spruce (Picea spp.), eastern hemlock
(Tsuga occidentalis), or balsam fir (A. balsamea), but are rare in pure
hardwood stands that do not contain oaks (Quercus spp.), hickories
(Carya spp.), or walnuts (Juglans spp.) [25,53]. In the mountains of
Virginia red squirrels occur in Table Mountain pine (Pinus pungens)-oak
forests [45].
  • 11. Ferner, John W. 1974. Habitat relationships of Tamiasciurus hudsonicus and Sciurus aberti in the Rocky Mountains. Southwestern Naturalist. 18: 470-473. [25245]
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 18. Hutchins, Harry E. 1994. Role of various animals in dispersal and establishment of whitebark pine in the Rocky Mountains, U.S.A. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 163-171. [24638]
  • 19. Kemp, Gerald A.; Keith, Lloyd B. 1970. Dynamics and regulation of red squirrel (Tamiasciurus hudsonicus) populations. Ecology. 51(5): 763-779. [25260]
  • 22. Klenner, Walt; Krebs, Charles J. 1991. Red squirrel population dynamics. I. The effect of supplemental food on demography. Journal of Animal Ecology. 60: 961-978. [25248]
  • 24. Larsen, Karl W.; Boutin, Stan. 1994. Movements, survival, and settlement of red squirrel (Tamiasciurus hudsonicus) offspring. Ecology. 75(1): 214-223. [22744]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 27. Patton, David R.; Vahle, J. Robert. 1986. Cache and nest characteristics of the red squirrel in an Arizona mixed-conifer forest. Western Journal of Applied Forestry. 1(2): 48-51. [25249]
  • 34. Rusch, Doris A.; Reeder, William G. 1978. Population ecology of Alberta red squirrels. Ecology. 59(2): 400-420. [25252]
  • 41. Sullivan, Thomas P.; Moses, Richard A. 1986. Red squirrel populations in natural and managed stands of lodgepole pine. Journal of Wildlife Management. 50(4): 595-601. [25255]
  • 46. Uphoff, Karin C. 1990. Habitat use and reproductive ecology of red squirrels (Tamiasciurus hudsonicus) in central Arizona. Tempe, AZ: Arizona State University. 64 p. Thesis. [23989]
  • 53. Obbard, Martyn E. 1987. Red squirrel. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Mallock, A. M., eds. Wild furbearer management and conservation in North America. 264-281. [25262]
  • 45. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]
  • 6. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: forb, hardwood

109 Ponderosa pine shrubland
409 Tall forb
809 Mixed hardwood and pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K001 Spruce-cedar-hemlock forest
K002 Cedar-hemlock-Douglas-fir forest
K004 Fir-hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine-subalpine forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K013 Cedar-hemlock-pine forest
K014 Grand fir-Douglas-fir forest
K015 Western spruce-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine-Douglas-fir forest
K019 Arizona pine forest
K020 Spruce-fir-Douglas-fir forest
K021 Southwestern spruce-fir forest
K022 Great Basin pine forest
K028 Mosaic of K002 and K026
K093 Great Lakes spruce-fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce-fir forest
K097 Southeastern spruce-fir forest
K099 Maple-basswood forest
K100 Oak-hickory forest
K102 Beech-maple forest
K103 Mixed mesophytic forest
K104 Appalachian oak forest
K106 Northern hardwoods
K107 Northern hardwoods-fir forest
K108 Northern hardwoods-spruce forest
K111 Oak-hickory-pine forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES14 Oak-pine
FRES15 Oak-hickory
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

1 Jack pine
5 Balsam fir
12 Black spruce
13 Black spruce-tamarack
14 Northern pin oak
15 Red pine
16 Aspen
18 Paper birch
19 Gray birch-red maple
20 White pine-northern red oak-red maple
21 Eastern white pine
22 White pine-hemlock
23 Eastern hemlock
24 Hemlock-yellow birch
25 Sugar maple-beech-yellow birch
26 Sugar maple-basswood
27 Sugar maple
30 Red spruce-yellow birch
31 Red spruce-sugar maple-beech
32 Red spruce
33 Red spruce-balsam fir
34 Red spruce-Fraser fir
35 Paper birch-red spruce-balsam fir
37 Northern white-cedar
38 Tamarack
40 Post oak-blackjack oak
51 White pine-chestnut oak
52 White oak-black oak-northern red oak
53 White oak
55 Northern red oak
78 Virginia pine-oak
107 White spruce
201 White spruce
202 White spruce-paper birch
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce-subalpine fir
208 Whitebark pine
209 Bristlecone pine
210 Interior Douglas-fir
211 White fir
212 Western larch
213 Grand fir
215 Western white pine
216 Blue spruce
218 Lodgepole pine
219 Limber pine
223 Sitka spruce
224 Western hemlock
225 Western hemlock-Sitka spruce
227 Western redcedar-western hemlock
228 Western redcedar
230 Douglas-fir-western hemlock
237 Interior ponderosa pine
251 White spruce-aspen
253 Black spruce-white spruce
254 Black spruce-paper birch

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range varies from 1-6 acres (Banfield 1974). In Alberta, most young settled close to mother's territory (maximum of 323 m from natal territory); of 219 births, only 20 offspring survived to the following spring (Larsen and Boutin 1994). In Minnesota, median dispersal distance for 8 young was 100 m, with 4 remaining in their natal ranges and 4 dispersing away (Sun 1997). In British Columbia, almost all juveniles settled on or adjacent to their natal territory (Haughland and Larsen 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Red squirrels are primarily granivorous, but they are also opportunistic omnivores in the absence of mast foods. Primary diet items vary with habitat and include the seeds of conifers and other tree types detailed below. They live in a resource pulse system, where foods (conifers like white spruce, Picea glauca) exhibit extreme annual variation. They consume a wide variety of mushrooms, including at least 45 species in the Cascade Mountains alone. Secondary food items include tree buds and flowers, fleshy fruits, tree sap, bark, insects, and other animal materials such as bird eggs or young snowshoe hares (Lepus americanus). During winter, spring, and early summer, bark stripping and tree girdling occurs commonly to access phloem and cambial tissues. Red squirrels are highly selective in their foraging behavior, harvesting cones from the tree species with the highest seed energy per cone first and systematically working their way through species of conifers by energy density per cone.

Red squirrels are primarily larder hoarders. In late summer through autumn, they harvest cones and store them in one or a few central middens. Middens are a central hoard that is easy to defend from competitors and provides a moist, cool environment that prevents cones from opening. Middens vary in size and number depending on habitat, food availability, and individual squirrel. However, they contain enough food to last one to two seasons and are often used by several generations of squirrels In the eastern United States and Canada, red squirrels frequently engage in scatter hoarding, which is a system involving many small hoards instead of a large midden. This accounts for 85% of all hoards and more than 50% of all cones stored in this area The downside to this type of storage is that middens only provides enough food for about 37 days. Red squirrels have a great sense of smell which they use when looking for middens during the winter. Some individuals store their food caches underground and are able to locate these seeds, even under 4 meters of snow. Whenever they do not recover a stockpile of food, the seeds are left to germinate.

Red squirrels pilfer food from other squirrels, but the extent varies greatly by population. Some squirrels the Yukon Territory of Canada almost never pilfer. Mt. Graham Red Squirrels, on the other hand, pilfer 97% of the time and in Vermont pilfering occurred 25% of the time. Age, boldness, and population density may play a role in pilfering.

Animal Foods: birds; mammals; eggs; insects

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit; flowers; sap or other plant fluids

Other Foods: fungus

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Granivore )

  • Dempsey, J., D. Keppie. 1993. Foraging patterns of eastern red squirrels. Journal of Mammalogy, 74: 1007-1013.
  • Donald, J., S. Boutin. 2011. Intraspecific cache pilferage by larder-hoarding red squirrels (Tamiasciurus hudsonicus). Journal of Mammalogy, 92/5: 1013-1020. Accessed October 22, 2011 at http://www.bioone.org/doi/full/10.1644/10-MAMM-A_340.1.
  • Hurly, T., R. Robertson. 1986. Scatter-hoarding by territorial red squirrels: a test of the optimal density model. Canadian Journal of Zoology, 65: 1247-1252.
  • Smith, C., O. Reichman. 1984. The evolution of food caching by birds and mammals. Annual Review of Ecology and Systematics, 15: 329-351.
  • Wilson, M., T. De Santo, K. Sieving. 2003. Red squirrels and predation risk to bird nests in northern forests. Canadian Journal of Zoology, 81/7: 1202-1208.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet consists of seeds, conifer cones, nuts, fruits. Occasionally feeds on invertebrates and small vertebrates. Commonly caches, and later consumes, large amounts of food; characterized by larderhoarding in the west, scatterhoarding in the east (Dempsey and Keppie, 1993, J. Mamm. 74:1007-1013). Also taps maple trees and consumes sugar residues (Heinrich, 1992, J. Mamm. 73:51-54).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Red squirrels are not picky eaters. They consume seeds, fruit, nuts, bark, buds, shed antlers, Squamata, Insecta, tree sap, pine cones, fungi (including mushrooms that are poisonous to humans), Aves, Peromyscus leucopus, and young Sylvilagus floridanus. However, red squirrels eat primary the seeds of conifer trees. They may eat up to 2/3 of the pine seed crop in an area each year. Red squirrels store many seeds and nuts underground, in piles, or under rocks for the winter. They are able to relocate these buried seeds 30 cm underground and 4 meters below snow with their tremendous sense of smell. Many seed stockpiles are not recovered, however, making red squirrels a key tree planter and seed disperser.

Animal Foods: birds; mammals; eggs; insects; terrestrial non-insect arthropods

Plant Foods: roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: competition, hardwood, tree

Red squirrels consume conifer seeds, nuts, buds, sap, tender leaves,
fruits, flowers, fungi, bird eggs, and small vertebrates [6]. In
captive trials white spruce seed alone sustained red squirrels for at
least 3 weeks. Red squirrels consumed seeds from an average of 144
cones per day per squirrel, probably more than they could consume in the
wild. Red squirrels lost weight on black spruce seed alone, and
preferred white spruce over black spruce seeds when presented with both
[2,3]. In Arizona each red squirrel was estimated to consume the seeds
of 42,000 to 131,000 pine cones per year [27,47]. On New Brunswick jack
pine sites, red squirrels consumed at least 47 cones per day [7].

In summer a larger array of foods is eaten, including elm (Ulmus spp.)
and maple (Acer spp.) seeds, raspberries (Rubus spp.) and other fruits,
and green cones of pines, Douglas-fir, hemlock, cedar, and larch (Larix
spp.). Some insects and nestling birds are also consumed [25]. In New
Hampshire red squirrels were observed preying on the eggs and young of
black-throated blue warblers (Dendroica caerulescens) [30]. Red
squirrels lap sap from trees damaged by yellow-bellied sapsuckers
(Sphyrapicus varius), and from other tree wounds [17]. They were also
observed licking sap and dried sugar from sap wells drilled by red-naped
sapsuckers (S. nuchalis) in Colorado [8]. In Vermont red squirrels were
observed biting holes in hardwood trees at periods associated with sap
flow. Sugar maple (Acer saccharum) was chosen more often than any other
tree. Rather than licking sap immediately, the red squirrels left the
fresh bite and returned at a later time, licking sap flows that had time
to evaporate into more concentrated sugar syrup or dried sugar. Sugar
spread by the researcher onto tree trunks did not immediately attract
red squirrels; it was inferred that red squirrels returned intentionally
to sap flows they had created [17].

The diet of the endangered Mount Graham red squirrel is not well known,
but is assumed to be similar to that of other red squirrels;
requirements include conifer seeds (mainly Engelmann spruce and
subalpine fir) and mushrooms [28].

In western North America cones are cached by red squirrels in a large
central location, often referred to as a midden (this type of food
storage is known as larderhoarding). Middens also contain other foods
such as seeds of other plant species, and mushrooms. Secondary middens
are also developed, usually at the base of a tree or tree cavity, but
are usually much smaller then the main midden [18,27]. Mushrooms are
sometimes left in tree branches and cached after they have dried [13].
It was suggested that larderhoarding may be a response to intense
predation in the winter; there is less movement involved in retrieving
cones from a cache than in searching for cones all winter [7].

In Wyoming red squirrels spent most of their foraging time in whitebark
pine forests finding and eating whitebark pine seed from cones or
recovering dropped whitebark pine seed. Cone harvesting may begin as
early as July 13 and cone caching usually begins by August 4. Red
squirrels often leave cones on the ground below the tree for up to 3
days before caching them [18]. In Colorado red squirrels appear to
prefer Douglas-fir cones over ponderosa pine cones; this may be a result
of interspecific competition with Abert's squirrels which require
ponderosa pine cones and bark [11]. In the Southwest commonly eaten and
preferred seeds include those of Douglas-fir, blue spruce, Engelmann
spruce, and white fir. Ponderosa pine seed is occasionally eaten in
Arizona [31].

In eastern North America red squirrels in conifer-dominated forests have
diets similar to those in western North America. In Maine red squirrels
remove northern white-cedar (Thuja occidentalis) branchlets and cones in
the fall, and consume branchlets with reproductive buds in the spring
[4]. Winter foods include terminal buds of conifers, boxelder (Acer
negundo) and red pine (Pinus resinosa) seeds, buds and sap of red maple
(A. rubrum), gray birch (Betula populifolia) and sugar maple, corn (Zea
mays), seeds of basswood (Tilia americana), sugar maple, silver maple
(A. saccharinum), Norway maple (A. platanoides), northern red oak
(Quercus rubra) and other oaks, hickory nuts, and butternuts (Juglans
cinera). Eastern hemlock (Tsuga canadensis) cones are a staple item in
some areas. Other winter foods include yellow-poplar (Liriodendron
tulipifera) and sycamore (Platanus occidentalis) seeds, fruits of
staghorn sumac (Rhus typhina) and smooth sumac (R. glabra), and bark.
In April and May red squirrels consume tree buds and flowers,
particularly those of American elm (Ulmus americana), sugar maple,
silver maple, Norway maple, northern red oak, and butternut [13,25,32].

In New Brunswick red squirrels are scatterhoarders rather than
larderhoarders; food is stored in small amounts in many places rather
than in one central midden. Red squirrels stored cones from both
serotinous and nonserotinous species: jack pine in central Ontario;
black, white, and red spruce (Picea rubens) in New Brunswick; and black
and red spruce in Maine. Cached cones are not sufficient for an entire
winter food supply; however, jack pine cones remain closed for at least
1 year and are retained on the tree for up to 7 years and therefore
provide a steady supply of winter food [7]. In Pennsylvania researchers
could not locate cone caches in marginal red squirrel habitat dominated
by aspens (Populus spp.). Red squirrels used a central location for
consuming cones; these feeding areas have been identified by the remains
of up to 103 cones [50].
  • 2. Brink, Charles Holden. 1964. Spruce seed as a food of the squirrels Tamiasciurus hudsonicus and Glaucomys sabrinus in interior Alaska. Fairbanks, AK: University of Alaska. 73 p. Thesis. [25160]
  • 3. Brink, C. Holden; Dean, Frederick C. 1966. Spruce seed as a food of red squirrels and flying squirrels in interior Alaska. Journal of Wildlife Management. 30(3): 503-512. [13253]
  • 4. Curtis, James D. 1946. Preliminary observations on northern white cedar in Maine. Ecology. 27: 23-36. [19804]
  • 7. Dempsey, Jeffrey A.; Keppie, Daniel M. 1993. Foraging patterns of eastern red squirrels. Journal of Mammalogy. 74(4): 1007-1013. [22613]
  • 8. Ehrlich, Paul R.; Daily, Gretchen C. 1988. Red-naped sapsuckers feeding at willows: possible keystone herbivores. American Birds. 42(3): 357-365. [14932]
  • 11. Ferner, John W. 1974. Habitat relationships of Tamiasciurus hudsonicus and Sciurus aberti in the Rocky Mountains. Southwestern Naturalist. 18: 470-473. [25245]
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 17. Heinrich, Bernd. 1992. Maple sugaring by red squirrels. Journal of Mammalogy. 73(1): 51-54. [25246]
  • 18. Hutchins, Harry E. 1994. Role of various animals in dispersal and establishment of whitebark pine in the Rocky Mountains, U.S.A. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 163-171. [24638]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 27. Patton, David R.; Vahle, J. Robert. 1986. Cache and nest characteristics of the red squirrel in an Arizona mixed-conifer forest. Western Journal of Applied Forestry. 1(2): 48-51. [25249]
  • 28. Pereira, Jose M. C.; Itami, Robert M. 1991. GIS-based habitat modeling using logistic multiple regression: a study of the Mt. Graham red squirrel. Photogrammetric Engineering and Remote Sensing. 57(11): 1475-1486. [25250]
  • 30. Reitsma, Leonard R.; Holmes, Richard T.; Sherry, Thomas W. 1990. Effects of removal of red squirrels, Tamiasciurus hudsonicus, and eastern chipmunks, Tamias striatus, on nest predation in a n. hardwood forest: an artificial nest experiment. Okios. 57(3): 375-380. [25356]
  • 31. Reynolds, Richard T.; Graham, Russell T.; Reiser, M. Hildegard; [and others]
  • 32. Riege, Dennis A. 1991. Habitat specialization and social factors in distribution of red and gray squirrels. Journal of Mammalogy. 72(1): 152-162. [25244]
  • 47. Vahle, J. Robert, Patton, David R. 1983. Red squirrel cover requirements in Arizona mixed conifer forests. Journal of Forestry. 81: 14-15, 22. [25259]
  • 50. Yahner, Richard H. 1987. Feeding-site use by red squirrels, Tamiasciurus hudsonicus, in a marginal habitat in Pennsylvania. The Canadian-Field Naturalist. 101: 586-589. [25257]
  • 6. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Red squirrels impact the forest ecosystem by dispersing seeds and fungi through caching and forgetting about or otherwise failing to return to food caches. The diversity and abundance of beneficial ectomycorrhizal fungi in these caches helps young trees acquire nutrients and grow. They limit the regrowth of trees by eating the seeds and inner tissues of the trees, which can cause significant damage to tree survival and value. Red squirrels provide a feeding opportunity for porcupines (Erethizontidae) during the winter by peeling away the bark of lodgepole pines. Their feeding habits also cause conifers to grow multiple tops, which reduces their timber value but increases suitable nest sites for many arboreal rodents (Rodentia) and passerine birds (Passeriformes). The increased availability of nest sites sustains species richness.

Red squirrels are host to a variety of endoparasites and ectoparasites. Endoparasitic species include 9 species of nematodes, 9 species of tapeworms including the genus (Hymenolepis). Other endoparasites include tularemia bacteria (Francisella tularensis) and Emmonsia crescens), and some kinds of protists like sarocysts (Sarocystis), and (Haplosporanigium). They are also vulnerable to fungal lung disease infection via adiaspiromycosis (Emmonsia parva). Ectoparasites of red squirrels include 31 species of mites, ticks, and chiggers (Glycyphagidae and Acarina), 25 species of fleas including Siphonaptera, Opisodasys robustus, Orchopeas caedens, Orchopeas neotomae, Orchopeas leucopus, Oropsylla idahoensis, Ceratophyllus vison. They may also carry botfly larvae (Cuterebra emasculator). Viruses that infect red squirrels are silverwater virus, California encephalitis virus, and Powassan virus.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Aubry, K., J. Hayes, B. Biswell, B. Marcot. 2003. Community and ecosystem relations. Ch. 12 The ecological role of tree-dwelling mammals in coniferous forests. University Publishing Online: Cambridge University Press. Accessed October 07, 2012 at http://ebooks.cambridge.org/chapter.jsf?bid=CBO9780511615757&cid=CBO9780511615757A019.
  • Edwards, J., M. Ford, D. Guynn. 2003. Wild Mammals of North America: Biology, Management, and Conservation. Baltimore, MD: John Hopkins University Press.
  • Sullivan, T., H. Coates, L. Jozsa, P. Diggle. 1993. Influence of feeding damage by small mammals on tree growth and wood quality in young lodgepole pine. Canadian Journal of Forest Research, 23: 799-809.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red squirrels are likely prey for a variety of animals including snakes, birds of prey, and carnivorous mammals. They are preyed upon by Cooper's hawks (Accipiter cooperii), northern goshawks (Accipiter gentilis), bald eagles (Haliaeetus leucocephalus), great gray owls (Strix nebulosa), great horned owls (Bubo virginianus), American kestrels (Falco sparverius), red-shouldered hawks (Buteo lineatus), northern harriers (Circus cyaneus), red-tailed hawks (Buteo jamaicensis), and sharp-shinned hawks (Accipiter striatus). Mammals that prey upon them them are American martens (Martes americana) and fishers (Martes pennanti), weasels (Mustela), mink (Neovison vison), as well as various canids like red foxes (Vulpes vulpes) and felids like lynx (Lynx canadensis). They are also preyed upon by timber rattlesnakes (Crotalus horridus). Humans hunt red squirrels for both their fur and meat.

Alarm calls are the most highly used anti-predator adaptations of red squirrels. Red squirrels tend to produce a high-frequency call for avian predators and a harsher bark-type call for terrestrial predators. However, it is more common that these two call types are mixed when any predator approaches. Red squirrels have a high survival rate even when subjected to heavy predation. It is very hard to catch and kill these animals because they are quite agile and take to the trees or thick vegetation to escape predators. Red squirrels are also fairly aggressive and when cornered, will not hesitate to defend themselves.

Known Predators:

  • Stuart-Smith, A., S. Boutin. 1995. Behavioral differences between surviving and depredated juvenile red squirrels. Ecoscience, 2: 34-40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Red squirrels can have a large impact on tree populations in two ways. They can severely limit the regrowth of conifer trees because they eat so many of their seeds. However, through their activities they also distribute the spores of beneficial fungi that help trees to acquire nutrients and grow and they accidentally plant the seeds of young trees, improving their chances of growing. Red squirrels are important prey animals for many small predators because of their abundance in the habitats in which they live.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Red squirrels are quick and agile and can escape predators by taking refuge in thick vegetation or in the trees. Red squirrels are also fairly aggressive small animals and will defend themselves if cornered.

Known Predators:

  • owls (Strigiformes)
  • hawks (Accipitridae)
  • weasels (Mustela)
  • snakes (Serpentes)
  • red foxes (Vulpes_vulpes)
  • bobcats (Lynx_rufus)
  • Canada lynx (Lynx_canadensis)
  • American martens (Martes_americana)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

The main predators of red squirrels in Alberta are raptors, probably
principally northern goshawk (Accipiter gentilis) [24]. Other red
squirrel predators include red-tailed hawk (Buteo jamaicensis), red fox
(Vulpes vulpes), bald eagle (Halieaatus leucocephalus), marten (Martes
americana), lynx (Lynx lynx) and ermine (Mustela erminea) [13,44]. Lynx
prey slightly more heavily on red squirrels in summer than winter (2% of
lynx winter diet, 9% of summer diet) [13]. Red squirrels comprised 5.6
percent of 36 prey deliveries to northern goshawk nests and 17.5 percent
of pellets (in 8 nests). More than 100 red squirrels were taken per
season by a single pair of breeding northern goshawks [31].

In Yellowstone National Park martens use the subnivean zone to get to
their prey which includes red squirrel. Red squirrels comprised 25
percent by volume of marten scats [37].
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 24. Larsen, Karl W.; Boutin, Stan. 1994. Movements, survival, and settlement of red squirrel (Tamiasciurus hudsonicus) offspring. Ecology. 75(1): 214-223. [22744]
  • 31. Reynolds, Richard T.; Graham, Russell T.; Reiser, M. Hildegard; [and others]
  • 37. Sherburne, Stuart S.; Bissonette, John A. 1993. Squirrel middens influence marten (Martes americana) use of subnivean access points. American Midland Naturalist. 129: 204-207. [25253]
  • 44. Thompson, I. D.; Davidson, I. J.; O'Donnell, S.; Brazeau, F. 1989. Use of track transects to measure the relative occurrence of some boreal mammals in uncut forest and regeneration stands. Canadian Journal of Zoology. 67: 1816-1823. [25256]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Tamiasciurus hudsonicus is prey of:
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tamiasciurus hudsonicus preys on:
Corylus
Pyrola
Cornus
Aralia
Pryola
Sitta canadensis
Sitta pygmaea
Certhia americana
Dendroica petechia
Junco hyemalis

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Densities range from about 1 per 3.2 ha (Pinaleno Mountains, southeastern Arizona) to 1 per 0.2 ha (Layne 1954, USFWS 1987).

More territorial than most other North Amerian tree squirrels. Some populations in British Columbia are limited by food (acting through effect on reproduction) (Sullivan 1990; see also J. Mamm. 73:930-936); but factors such as territorial behavior may limit populations at high density (Klenner and Krebs 1991, Klenner 1991).

Sciurid mycophagy may play important role in forest ecology (Maser and Maser 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: prescribed fire, succession

Kirkpatrick and Mosby [20] suggested that prescribed fire in southern
pine-hardwood sapling and older stages is unlikely to affect resident
tree squirrels. This may apply to red squirrels, since important
habitat includes mature trees unlikely to be adversely affected by
low-severity fire. Fire severe enough to cause basal fire wounds may
increase cavities available for food caches. Basal fire wounds are
unlikely to increase cavities useful as nests for red squirrels [20].

In Yellowstone National Park lodgepole pine stands monitored for
presence of birds and mammals during postfire succession, red squirrels
were only present in stands with closed canopies [42]. In north-central
Colorado red squirrels were not present on 8-year-old burned areas but
were present in adjacent unburned lodgepole pine stands [33].

The maintenance of many mature coniferous forest types is often
dependent on fire. Ponderosa pine, Douglas-fir, lodgepole pine,
whitebark pine, and spruces are either dependent on stand-replacing
fires for regeneration or on low-severity fires for maintenance. Even
though severe fire is immediately destructive of red squirrel habitat,
the long-term maintenance of most coniferous forests is dependent on
fire [57].
  • 20. Kirkpatrick, Roy L.; Mosby, Henry S. 1981. Effect of prescribed burning on tree squirrels. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 99-101. [14815]
  • 33. Roppe, Jerry A.; Hein, Dale. 1978. Effects of fire on wildlife in a lodgepole pine forest. Southwestern Naturalist. 23(2): 279-287. [261]
  • 42. Taylor, Dale L. 1974. Biotic succession of lodgepole pine forests of fire origin in Yellowstone National Park. A report to the National Geographic Society. Paper on file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. 15 p. [16794]
  • 57. Kozlowski, T. T.; Ahlgren, C. E., eds. 1974. Fire and ecosystems. New York: Academic Press. 542 p. [1374]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: litter, tree

Diurnal Activity: Red squirrels are diurnal and active year-round. Peak
activity occurs 2 hours after sunrise and just before sunset, but
red squirrels are active most of the daylight hours [25].

Movement: Rusch and Reeder [34] reported that red squirrels move from
quaking aspen and pine stands to spruce stands in the spring. Fall
movements are largely those of juveniles moving away from denser
populations of adults in spruce stands.

Breeding Season: Red squirrel breeding season varies with latitude and
elevation. Generally, the breeding season peaks from March to August,
but breeding may begin as early as January and continue as late as
October. Mating is promiscuous [13,25].

Nesting and Litter Size: Female red squirrels prefer to nest in natural
tree cavities or abandoned woodpecker (Picidae) holes. If none are
available they build a leaf [25] or grass nest [27] in the crotch of a
limb high on a densely foliated tree, or use a fallen tree, rock pile,
underground burrow, or man-made structure. There are usually four or
five young per litter (range: one to eight). Generally there is only
one litter per year, but occasionally a female bears two litters in one
year [25].

Development of Young: Red squirrel young are born naked and blind. By
6 days there is noticeable fur growth and by 20 days there is a good
covering of dorsal fur. Their eyes open at 27 to 35 days. They are
mostly furred by about 8 weeks. The young red squirrels begin making
limited excursions from the nest at 6 to 7 weeks, and forage at a
greater distance by about 10 weeks [25]. Weaning occurs at about 7 to 8
weeks in New York [25] and about 10 weeks in Alberta [24]. Dispersal
usually begins at about 12 to 14 weeks [25]. Female red squirrels in
Canada usually do not breed until their second year. Males develop
scrotal testes their first spring but it is not known whether they breed
at that time [24].

Dispersal of Juveniles: Juvenile red squirrels disperse in the fall in
search of suitable territory [21]. In Alberta initial movements are
circular; unsuccessful juveniles usually return to the natal territory
until they are successful or are killed. Occasionally juveniles will
appropriate the mother's territory [24]. Survival of juveniles depends
on establishment of a territory with a food supply adequate for the
entire winter [22]. Juveniles surviving their first winter tended to be
relatively far away from the natal territory. They appeared to have
acquired larger territories than juveniles that died, with middens that
were constructed by previous owners [24].

Red squirrels tend to disperse and establish territories in relation to
major resources (mature cone-bearing trees) [22]. In south-central
British Columbia relocation of resident adult squirrels a substantial
distance from the study site allowed researchers to monitor red squirrel
recruitment rates. In the fall red squirrel population density
recovered to control levels on four out of six sites; immigrants were
mostly juveniles. In the spring, breeding red squirrel population
density recovered to control levels on five out of the six sites; these
sites were also colonized by juveniles in the fall [21].

Mortality and Longevity: In Alberta average annual mortality was 67
percent for juveniles, 34 percent for adult yearlings, and 61 percent
for older adults [19]. Larsen and Boutin [24] reported annual adult
survivorship for red squirrels in Alberta as 67 to 71 percent. Captive
red squirrels have lived at least 9 years and wild red squirrels have
lived at least 10 years [25].
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 19. Kemp, Gerald A.; Keith, Lloyd B. 1970. Dynamics and regulation of red squirrel (Tamiasciurus hudsonicus) populations. Ecology. 51(5): 763-779. [25260]
  • 21. Klenner, Walt. 1991. Red squirrel population dynamics. II. Settlement patterns and the response to removals. Journal of Animal Ecology. 60: 979-993. [25247]
  • 22. Klenner, Walt; Krebs, Charles J. 1991. Red squirrel population dynamics. I. The effect of supplemental food on demography. Journal of Animal Ecology. 60: 961-978. [25248]
  • 24. Larsen, Karl W.; Boutin, Stan. 1994. Movements, survival, and settlement of red squirrel (Tamiasciurus hudsonicus) offspring. Ecology. 75(1): 214-223. [22744]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 27. Patton, David R.; Vahle, J. Robert. 1986. Cache and nest characteristics of the red squirrel in an Arizona mixed-conifer forest. Western Journal of Applied Forestry. 1(2): 48-51. [25249]
  • 34. Rusch, Doris A.; Reeder, William G. 1978. Population ecology of Alberta red squirrels. Ecology. 59(2): 400-420. [25252]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Red squirrels have well-developed and extremely acute senses of smell, sight, and hearing. They are well known for their ability to communicate by calls. These calls consist of rattles, screeches, growls, buzzes and chirps and are often used in defense of territory or in response to threats from predators. During mating, red squirrels use low aggressive calls or territorial calls to drive off subordinate males. Red squirrels may even be able to recognize each other by individual call. Communication is important because of their territorality. They intensively use vocal communication to advertise these territories and to threaten other squirrels. Both vocal and scent marking aid in the recognition of individuals. Olfactory communication is important because it can leave long-lasting impressions which advertise if the territory is taken and males can discriminate between different olfactory signatures of other males. Another reason chemical communication is advantageous is because it may also reduce predation risk. Scent marking may also enable the squirrels to avoid unnecessary chases and fights by becoming known to their neighbors. Red squirrels may also be able to make predator-specific calls, but evidence of this is still very inconclusive. Red squirrels tend to produce a high-frequency call for aerial predators and a harsher, bark-type call for terrestrial predators. However, it is more commonly observed that these two call types are mixed.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Digweed, S., D. Rendall. 2010. Are the alarm calls of North American red squirrels (Tamiasciurus hudsonicus) functionally referential?. Behaviour, 147: 1201-1218. Accessed January 03, 2012 at http://classes.uleth.ca/201003/biol4850a/Ch14C%20Low%20Priority%20Digweed.pdf.
  • Greene, E., T. Meagher. 1998. Red squirrels, Tamiasciurus hudsonicus, produce predator-class specific alarm calls. Animal Behavior, 55/3: 511-518. Accessed January 03, 2012 at http://www.ncbi.nlm.nih.gov/pubmed/9514668.
  • Price, K., K. Broughton, S. Boutin, A. Sinclair. 1986. Territory size and ownership in red squirrels: response to removals. Canadian Journal of Zoology, 64: 1144-1147.
  • Vache, M., J. Ferron, P. Gouat. 2001. The ability of red squirrels (Tamiasciurus hudsonicus) to discriminate conspecific olfactory signatures. Canadian Journal of Zoology, 79/7: 1296-1300. Accessed January 03, 2012 at http://www.nrcresearchpress.com/doi/abs/10.1139/z01-085?journalCode=cjz.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Red squirrels have keen senses of smell, sight, and hearing. They are very vocal and loudly scold intruders in their home range. Vocalizations consist of rattles, screeches, growls, buzzes, and chirps.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Usually quite conspicuous throughout the day. Most active 2 hours after sunrise and before sunset.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Red squirrels exhibit a type 3 survivorship curve in wild populations. This means that most of the mortality is associated with deaths of the young and only 25% survive longer than 1 year. Despite their small size, red squirrels are considered relatively long lived, with the oldest known squirrel in the wild reaching 10 years of age. The longest recorded lifespan in captivity is 9 years. Mature squirrels are 2 to 4 years old and older squirrels are considered to be over 5 to 6 years old. Their average lifespan in the wild is 5 years.

Range lifespan

Status: wild:
10 (high) years.

Range lifespan

Status: captivity:
9 (high) years.

Average lifespan

Status: wild:
5 years.

Average lifespan

Status: captivity:
9.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Red squirrels can live up to 7 years in the wild, though most will die before they are 1 year old. One captive red squirrel lived 9.8 years.

Range lifespan

Status: wild:
7 (high) years.

Range lifespan

Status: captivity:
9.8 (high) years.

Average lifespan

Status: captivity:
9.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.8 years (captivity) Observations: One captive specimen lived 9.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Red squirrels have a defined breeding season lasting 105 days that can occur either once or twice a year. They will mate in early spring from March to May and then again in August to early September. A second breeding period tends to occur in warmer areas of their range. Although mate pairings may occur, red squirrels are generally characterized as promiscuous. Animals in the best condition tend to breed more regularly and successfully than animals in poor condition.

Red squirrels exhibit a scramble competition mating system, in which the main costs to males are locating receptive females. Males typically invade the territory of females in estrus and pursue them in obvious mate chases. During mate chasing, a single dominant male actively pursues a female and drives off other subordinate males using calls or direct chase. Mounting and copulation usually lasts several minutes and occurs several times in the afternoon of the only day the female is receptive. Copulation is frequently initiated by the female and terminated by the male. Mating most often occurs on the ground or in the lower branches of trees. During mating, the male holds the female around the posterior abdomen while resting his head on her back. It is common for both males and females to engage in grooming of the genitals before and after copulation. The adults have no further contact after mating and the male returns to his territory.

Mating System: polygynandrous (promiscuous)

Red squirrels breed once or twice a year, depending on their geographic location. Populations in the south and east generally have two litters a year, one in spring and one in late summer. This pattern occurs all the way up to Quebec and has also occurred in British Colombia. In the northern extent of their range, breeding only occurs once a year, generally in spring. In the eastern United States, two breeding seasons per year is common, one in March and a second in late July. Harsher conditions at the northern latitudes and higher elevations of the squirrels' range most likely limit reproduction to a single breeding season. Interannual variation in female reproduction is also common; there was a halving in the number of breeding females over 2 years in British Columbia. Their reproductive cycle has adapted to the cyclical production of conifer cone output. Female estrus is highest in February to March and June to July. Pregnancy peaks in March to April and August to September in New York. In Colorado, conception generally occurs April to June.

Females are in estrus only 1 day per breeding season. Conception usually occurs within a few hours of mating. Gestation averages 35 days. Newborn young weigh 7.08 g on average. Litter sizes range from 1 to 8 offspring but averages 3.97. Altricial young are born without any hair except vibrissae and fine chin hairs, but develop quickly. The external auditory meatus is obvious at 18 days, eyes open at 26 to 35 days, and pelage is fully developed in only 40 days. Lactation occurs for the first 70 days. After that time, young are cast out to find their own territory. In some cases when the mother is in poor condition she will give part of her territory to her offspring. This increases the probability of survival for the offspring, increasing the overall fitness the mother. Young are active outside the nest in 7 weeks and fully independent shortly after weaning. Dentition is complete and external skeletal measurements reach adult size by 125 days.

Most red squirrel nests are constructed within 30 m of cone caches. Red squirrels prefer natural cavities, but due to lack of such resources in coniferous forests, they construct leaf nests or occasionally underground nests. The most important factors influencing nest-tree selection are tree diameter and branching structure, and the availability of canopy escape routes. Nests are found at heights of 2 to 20 m, and while nest material varies with habitat, they typically include grasses, mosses, inner cambium, shredded bark leaves, feathers, and fur.

Reproduction is dependent on resource abundance. Red squirrels live in a resource-pulse system, where the main food (in most cases the seeds of conifer species like white spruce) fluctuates annually, in some cases spanning three orders of magnitude between failure and mast years. Food available for reproduction in the spring is determined by the abundance of cones produced the previous year. The reliance on and the defense of individual caches allows females to have the potential to assess the level of stored food that is available for current reproduction. However, female squirrels do not have a smaller litter in years of crop failure, so reproduction is expected to be more costly during these years.

Age also affects reproductive cycles in both male and female red squirrels. Females and males are sexually mature at 1 year of age but are still developing. Despite the detriment to their own health by trying to breed and grow simultaneously, 1-year-old females tend to reproduce because they can achieve higher lifetime reproductive success than females delaying their first reproduction. This is also true for young males. Mature females tend to engage in a conservative reproductive strategy in order to allocate reproductive resources only when their own survival costs are maintained. This is not the case for females over 6 years old, who tend to sacrifice their own survival for reproduction because they are unlikely to be able to breed again the following year. Reproduction senescence occurs from 4 years of age onwards.

Breeding interval: Red squirrels breed once or twice a year, depending on their geographic location.

Breeding season: The time of breeding depends on their geographic location.

Range number of offspring: 1 to 8.

Average number of offspring: 3.97.

Average gestation period: 35 days.

Average weaning age: 70 days.

Average time to independence: 7 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; sperm-storing

Average birth mass: 7 g.

Average gestation period: 37 days.

Average number of offspring: 4.2.

Average age at sexual or reproductive maturity (female)

Sex: female:
342 days.

Females raise the young without any help from males. Gestation averages 35 days and lactation is 70 days. After this the young are no longer dependent on the mother and the offspring relocate to find territories of their own. Mothers sometimes bequeath territories, giving part or all of their territory to one or more of their offspring. This increases the offspring’s’ probability of overwinter survival.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Hayssen, V. 2008. Patterns of Body and Tail Length and Body Mass in Sciuridae. Journal of Mammalogy, 89/4: 852-873.
  • Boutin, S., K. Larsen. 1993. Does food availability affect growth and survival of males and females differently in a promiscuous small mammal, Tamiasciurus hudsonicus?. Journal of Animal Ecology, 62: 364-370.
  • Boutin, S., L. Wauters, A. McAdam, M. Humphries. 2006. Anticipatory reproduction and population growth in seed predators. Science, 314: 1928-1930.
  • Descamps, S., S. Boutin, A. McAdam, D. Berteaux, J. Gaillard. 2009. Survival costs of reproduction vary with age in North American red squirrels. Proceedings of the Royal Society of London. Series B: Biological Sciences, 276: 1129-1135.
  • Gurnell, J. 1984. Home range, territoriality, caching behavior and food supply of the red squirrel (Tamiasciurus hudsonicus) in a subalpine forest. Animal Behavior, 32: 1119-1131.
  • Humphries, M., S. Boutin. 2000. The determinants of optimal litter size in free-ranging red squirrels. Ecology, 81: 2867-2877.
  • Lane, J., S. Boutin, J. Speakman, M. Humphries. 2010. Energetic costs of male reproduction in a scramble competition mating system. Journal of Animal Ecology, 79: 27-34.
  • Layne, J. 1952. The Os Genitale of the red squirrel, Tamiasciurus. Journal of Mammalogy, 33/4: 457-459.
  • Linzey, A., D. Linzey. 1971. Mammals of Great Smoky Mountains National Park. Knoxville: The University of Tennessee Press, 114 p.
  • McAdam, A., S. Boutin, A. Sykes, M. Humphries. 2007. Life histories of red squirrels and their contributions to population growth and lifetime fitness. Ecoscience, 14: 362-369.
  • McAdam, A., S. Boutin. 2003. Variation in viability selection among cohorts of juvenile red squirrels (Tamiasciurus hudsonicus). Evolution, 57: 1689-1697.
  • Millar, J. 1970. The breeding season and reproductive cycle of the western red squirrel. Canadian Journal of Zoology, 48: 471-473.
  • Nice, M., C. Nice, D. Ewers. 1954. Comparison of behavioral development in snowshoe hares and red squirrels. Journal of Mammalogy, 37: 64-74.
  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington (D.C.): Smithsonian Institution Press in association with the American Society of Mammalogists.
  • Smith, C. 1968. The adaptive nature of social organization in the genus of tree squirrels Tamiasciurus. Ecology Monographs, 38: 31-63.
  • Steele, M. 1998. Mammalian Species. Pp. 1-9 in Tamiasciurus hudsonicus, Vol. 586. American Society of Mammalogists.
  • Wirsing, A., T. Steury, D. Murray. 2002. Relationship between body condition and vulnerability to predation in red squirrels and snowshoe hares. Journal of Mammalogy, 83/3: 707-715. Accessed November 03, 2011 at http://www.asmjournals.org/doi/abs/10.1644/1545-1542(2002)083%3C0707%3ARBBCAV%3E2.0.CO%3B2.
  • Wrigley, R. 1969. Ecological notes on the mammals of southern Quebec. Canadian Field-Naturalist, 83: 201-211.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds March-April and June-July in Quebec. Gestation lasts 31-35 days (Lair 1985). Some females produce 2 litters/year; litter size averages 4-5. Some females breed when less than one year old (Lair 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In warmer climates there are two breeding seasons, in the late winter and mid-summer. In colder climates, there is only one which begins at the spring thaw, from mid-January to mid-February. She gives birth, after a 33 to 35 day pregnancy, in a lined den or tree hollow, to from 1 to 8 young. Litter size is typically 2 to 5. The young develop very quickly and are weaned 7 to 8 weeks after birth. At 40 days old they leave the nest. Juvenile mortality is high, with owls, hawks, and pine martens taking many individuals. About 25% survive to adulthood, which is achieved around one year after young are born.

Breeding interval: Red squirrels can breed several times in the breeding season.

Breeding season: Breeding is from mid-January to mid-February.

Range number of offspring: 1 to 8.

Range gestation period: 33 to 35 days.

Range weaning age: 7 to 8 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 7 g.

Average number of offspring: 4.2.

Average age at sexual or reproductive maturity (female)

Sex: female:
342 days.

Females care for and nurse their young in the nest for 40 days. In the fall following their birth the young disperse from their mother's home range.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Ruff, S., D. Wilson. 1999. The Smithsonian Book of North American Mammals. Washington [D.C.]: Smithsonian Institution Press in association with the American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tamiasciurus hudsonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTGTATCTGCTATTTGGTGCTTGAGCCGGAATAGTTGGGACGGCCCTTAGTCTACTAATTCGTGCAGAATTAGGGCAGCCAGGAGCCCTTCTAGGAGATGACCAGATTTATAATGTAATCGTAACTGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCTATTATAATCGGGGGGTTTGGGAATTGACTGGTTCCCCTTATAATTGGAGCCCCTGATATAGCATTCCCACGCATGAACAATATAAGCTTCTGACTTCTGCCCCCTTCATTTCTCCTACTACTCGCCTCATCCATGGTTGAAGCTGGAGCGGGTACCGGCTGAACGGTGTACCCACCACTGGCCGGAAATTTAGCCCACGCAGGAGCCTCTGTCGACCTGACAATCTTTTCACTCCACTTAGCTGGTGTATCTTCAATTTTAGGGGCAATTAACTTTATTACTACAATTATTAATATAAAACCACCTGCTATGTCCCAATATCAAACCCCATTGTTTGTTTGGTCCGTCCTAATTACAGCCGTCCTACTACTTCTCTCTCTTCCAGTTCTAGCGGCAGGAATTACTATACTTCTAACAGACCGAAATCTAAATACAACTTTTTTTGACCCTGCCGGAGGAGGAGACCCTATTTTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tamiasciurus hudsonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

As of 2008, red squirrels are classified as Least Concern on the ICUN Red List and by the United States government. They are widespread and common, have suitable habitat throughout their range, and face no major threats. One subspecies, Mt. Graham red squirrels (Tamiasciurus hudsonicus grahamensis), is endangered according to the ICUN Red List. This subspecies is only found in southeast Arizona and its population is about 150 individuals.

US Federal List: endangered

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G., Koprowski, J. & Roth, L. (Small Nonvolant Mammal Red List Authority)

Contributor/s

Justification
Listed as Least Concern because it is very widespread, common in suitable habitat throughout its range, and there are no major threats.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in North America; abundant in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red squirrels are common and not currently threatened throughout most of their range. A subspecies, the Mt. Graham red squirrel in southeastern Arizona, has been reduced to 150 individuals and is listed as endangered. A new observatory complex, campgrounds, and continued logging threatens its last habitat.

IUCN Red List of Threatened Species: least concern

US Federal List: endangered; no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent changes
in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

The Mount Graham red squirrel (T. h. ssp. grahamensis)is Endangered [45].
  • 45. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Mount Graham red squirrel, T. hudsonicus grahamensis, is Critically Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is widespread in North America, and abundant in many areas. Densities of up to 7-8 per hectare have been reported.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The range of this species includes several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, formation, natural, selection, tree

Red squirrels are considered pests in some areas where they consume a
large proportion of available conifer seeds. It has been suggested that
they interfere with natural regeneration of conifers by removing most of
the seed crop; this is particularly detrimental in years with poor cone
crops [12,13,51]. Cached seed and cones do not usually germinate; a
seed fungus (Caloscypha fulgens), which appears to prevent germination
and rotting of seeds, is encouraged by the moist, cool conditions
usually found in red squirrel cache sites [53,54]. In Newfoundland red
squirrels are a recent introduction and have become a serious threat to
black spruce cone harvests for commercial seed production [48]. Red
squirrels clip (and often consume) terminal buds and peel the bark of
trees, occasionally girdling stems. Gnawing damage to trees sometimes
causes canker formation [13]. In Arizona red squirrels harvested more
than 80 percent of limber pine (Pinus flexilis) cones before the cones
opened (making the seeds unlikely to germinate even if they are not
consumed); in open sites where red squirrels were absent more than 70
percent of cones opened on the trees [9].

In Newfoundland harvesting black spruce cones in August or September is
recommended in order to anticipate removal of cones by red squirrels
[48]. In central British Columbia thinning of 20-year-old lodgepole
stands resulted in a reduction in red squirrel populations but did not
appreciably lower the amount of tree damage inflicted by red squirrels
gnawing on bark [41].

Red squirrels and other mycophagous species probably play an important
role in the dispersal of the spores of mycorrhiza-forming fungi and
therefore benefit conifer reproduction [26]. Red squirrel middens are a
source of conifer seed for forestry in some western states [12,13].

Habitat management: Red squirrels are dependent on mature conifers for
food and cover. Conifer plantings in suburban areas tend to encourage
red squirrels. Red squirrels will use nest boxes if they are placed in
suitable habitat [13]. Vahle and Patton [27,47] recommended maintenance
of areas with closely spaced groups of trees of different ages and sizes
for red squirrel habitat. Conifers larger than 15 inches (38 cm) d.b.h.
are necessary for cone production; at least three or four large trees
per acre are needed. Timber harvest using group selection promotes
habitats favored for red squirrel cache sites [47]. Reynolds and others
[31] listed specific management recommendations for red squirrels in the
Southwest in conjunction with maintenance of northern goshawk prey base.

Black bears (Ursus americanus) damaged trees adjacent to Mount Graham
red squirrel middens more often than at random locations. This damage
frequently kills the tree. Death of the tree results in loss of cone
production, but it also provides snags for nest cavities and storage
sites [39]. The endangered grizzly bear (U. arctos horribilis)
excavates red squirrel cone caches in whitebark pine stands; this is an
important grizzly bear food source in some areas. Grizzly bear habitat
management includes encouragement of both whitebark pine and red
squirrel [56].

Red squirrels are economically important furbearers in Canada [19,53].
More red squirrels are taken but the total value is less than that of
other furbearers [53].

Parasites and diseases of red squirrels were summarized by Layne [25]
and Flyger and Gates [13].
  • 9. Benkman, Craig W. 1982. Co-adaptations of red squirrels and Clark's nutcrackers with limber pine. Flagstaff, AZ: Northern Arizona University. 95 p. Thesis. [428]
  • 12. Finley, Robert B., Jr. 1969. Cone caches and middens of Tamiasciurus in the Rocy Mountain region. University of Kansas Museum of Natural History. Misc. Publ. No. 51: 233-273. [25242]
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]
  • 19. Kemp, Gerald A.; Keith, Lloyd B. 1970. Dynamics and regulation of red squirrel (Tamiasciurus hudsonicus) populations. Ecology. 51(5): 763-779. [25260]
  • 25. Shilts, Dean M. 1982. Fire management in Wind Cave National Park. In: Lotan, James E., ed. Fire--its field effects: Proceedings of the symposium; 1982 October 19-21; Jackson, WY. Missoula, MT: The Intermountain Fire Council: Pierre, SD: The Rocky Mountain Fire Council: 51-56. [10990]
  • 26. Maser, Chris; Trappe, James M.; Ure, Douglas C. 1978. Implications of small mammal mycophagy to the management of western coniferous forests. Proceedings, 43rd North American Wildlife Conference: 78-88. [7174]
  • 27. Patton, David R.; Vahle, J. Robert. 1986. Cache and nest characteristics of the red squirrel in an Arizona mixed-conifer forest. Western Journal of Applied Forestry. 1(2): 48-51. [25249]
  • 31. Reynolds, Richard T.; Graham, Russell T.; Reiser, M. Hildegard; [and others]
  • 39. Smith, Andrew A.; Mannan, R. William; Davis, Russell. 1992. Black bear damage to old-growth trees around middens of Mount Graham red squirrels. In: Kaufmann, Merrill R.; Moir, W. H.; Bassett, Richard L., technical coordinators. Old-growth forests in the southwest and Rocky Mountain regions: Proceedings of a workshop; 1992 March 9-13; Portal, AZ. Gen. Tech. Rep. RM-213. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 179-183. [19053]
  • 41. Sullivan, Thomas P.; Moses, Richard A. 1986. Red squirrel populations in natural and managed stands of lodgepole pine. Journal of Wildlife Management. 50(4): 595-601. [25255]
  • 47. Vahle, J. Robert, Patton, David R. 1983. Red squirrel cover requirements in Arizona mixed conifer forests. Journal of Forestry. 81: 14-15, 22. [25259]
  • 48. West, R. J. 1989. Cone depredations by the red squirrel in black spruce stands in Newfoundland: implications for commercial cone collection. Canadian Journal of Forest Research. 19: 1207-1210. [25243]
  • 51. Zasada, John C.; Van Cleve, Keith; Werner, Richard A.; [and others]
  • 53. Obbard, Martyn E. 1987. Red squirrel. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Mallock, A. M., eds. Wild furbearer management and conservation in North America. 264-281. [25262]
  • 54. Sullivan, Thomas P.; Sutherland, Jack R.; Woods, T. A. D.; Sullivan, Druscilla S. 1984. Dissemination of the conifer seed fungus Caloscypha fulgens by small mammals. Canadian Journal of Forest Research. 14: 134-137. [25357]
  • 56. Mattson, David J.; Reinhart, Daniel P. 1994. Bear use of whitebark pine seeds in North America. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 212-220. [24645]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Red squirrels cause considerable economic losses. They interfere with conifer reforestation by eating 60 to 100% of cone crops and directly damaging trees through bud consumption and bark stripping. Squirrels also cause damage to human property by nesting in homes and gnawing on household items. They may bite humans if provoked.

Negative Impacts: injures humans (bites or stings); household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red squirrels are the third-most commonly harvested furbearer in Canada, bringing in about $1 million annually. Each year in Minnesota, thousands of red squirrels are harvested for consumption by humans. Red squirrels are an important prey item for other economically important species like lynx (Lynx) and martens (Martes).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Red squirrels can severely damage young trees in plantations, and crops in storage. They may also gnaw on many household items and can become a nuisance if they nest in homes.

Negative Impacts: crop pest; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Red squirrels are beneficial because of their dispersal of tree seeds and the spores of fungi required by many trees for successful growth. About 1 to 3 million red squirrels are harvested annually for their fur in Canada, bringing in about $1 million. They are a major prey item for other economically important species such as martens, bobcats, and lynx.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American red squirrel

For the Eurasian species, see red squirrel.

The American red squirrel (Tamiasciurus hudsonicus) is one of three species of tree squirrel currently classified in the genus Tamiasciurus, known as the pine squirrels (the others are the Douglas squirrel, T. douglasii and Mearns's squirrel, T. mearnsi). American red squirrels are also referred to as pine squirrels, North American red squirrels, chickarees, and fairydiddles. They are medium-sized (200–250 g) diurnal mammals that defend a year-round exclusive territory. The diet of these tree squirrels is specialized on the seeds of conifer cones. As such, they are widely distributed across North America wherever conifers are common, except on the Pacific coast, where they are replaced by Douglas squirrels. Recently, American red squirrels have been expanding their range to include primarily hardwood areas.[3]

Taxonomy[edit]

American red squirrels should not be confused with Eurasian red squirrels (Sciurus vulgaris); since the ranges of these species do not overlap, they are both commonly referred to as "red squirrels" in the areas where they are native. The specific epithet hudsonicus refers to Hudson Bay, Canada, where the species was first catalogued by Erxleben in 1771.[4] A recent phylogeny suggests the squirrels as a family can be divided into five major lineages. Red squirrels (Tamiasciurus) fall within the clade that includes flying squirrels and other tree squirrels (e.g., Sciurus).[5] There are 25 recognized subspecies of red squirrels.[6]

Description[edit]

Red squirrels can be easily identified from other North American tree squirrels by their smaller size, territorial behavior and reddish fur with a white venter (underbelly).[6] Red squirrels are somewhat larger than chipmunks. The Douglas squirrel is morphologically similar to the American red squirrels, but has a rust-colored venter and is restricted to the southwestern coast of British Columbia and in the Pacific Northwest of the United States. These species' ranges do not overlap.

Distribution[edit]

Front view, Gatineau Park, Quebec

American red squirrels are widely distributed across the North American continent. Their range includes most of Canada, the southern part of Alaska, coastal British Columbia, and the Rocky Mountains and boreal forests east to the Atlantic coast.[6][7] American red squirrels are abundant and not of conservation concern throughout much of their range. However, an isolated population of red squirrels in Arizona has experienced considerable declines in population size. In 1987, this portion of the population was listed as an endangered species.[8]

Behavior[edit]

Feeding[edit]

Eating nut, in Edmonton, Alberta, 2013

American red squirrels are primarily granivores, but incorporate other food items into their diets opportunistically.[6] In the Yukon, extensive behavioral observations suggest white spruce seeds (Picea glauca) comprise over 50% of a red squirrel's diet,[9] but squirrels have also been observed eating spruce buds and needles, mushrooms, willow (Salix sp.) leaves, poplar (Populus sp.) buds and catkins, bearberry (Arctostaphylos sp.) flowers and berries, and animal material such as bird eggs or even snowshoe hare leverets (young).[10] White spruce cones mature in late July and are harvested by red squirrels in August and September. These harvested cones are stored in a central cache and provide energy and nutrients for survival over the winter and reproduction the following spring. The fallen scales from consumed seed cones can collect in piles, called middens, more than a meter across. White spruce exhibits two- to six-year masting cycles, where a year of superabundant cone production (mast year)[11] is followed by several years in which few cones are produced.[12] American red squirrel territories may contain one or several middens.

American red squirrels eat a variety of mushroom species, including some that are deadly to humans.[13] They clip and gather truffles and other fungi and place them amongst the branches of trees to dry them in the sun.[14][15][16]

Reproduction[edit]

American red squirrels are spontaneous ovulators.[17][18] Females enter estrus for only one day, but venture from their territory prior to ovulation, and these exploratory forays may serve to advertise their upcoming estrus. On the day of estrus, females are chased by several males in an extended mating chase. Males compete with one another for the opportunity to mate with the estrous female. Estrous females will mate with 4 to 16 males. Gestation has been reported to range from 31 to 35 days.[19] Females can breed for the first time at one year of age, but some females delay breeding until two years of age or older. Most females produce one litter per year, but in some years reproduction is skipped, while in other years some females breed twice. Litter sizes typically range from one to five, but most litters contain three or four offspring. Offspring are pink and hairless at birth and weigh about 10 g. Offspring grow at approximately 1.8 g/day while nursing, and reach adult body size at 125 days. They first emerge from their natal nests at around 42 days, but continue to nurse until approximately 70 days.

Nests are most commonly constructed of grass in the branches of trees. Nests are also excavated from witches’ broom—abnormally dense vegetative growth resulting from a rust disease—or cavities in the trunks of spruce, poplar, and walnut trees. American red squirrels rarely nest below ground. Each individual squirrel has several nests within its territory, and females with young move them between nests. Some behavior has been reported within human dwellings using insulation as nesting fodder.

A three-year study of a population of red squirrels in southwest Yukon reported female red squirrels showed high levels of multiple-male mating and would even mate with males with similar genetic relatedness. While males mating with multiple females is quite common in the animal kingdom, females that mate with multiple males is rarer. When female red squirrels chose a mate, genetic relatedness did not play a factor. The relatedness of parents had no effect on the neonatal mass and growth rate of their offspring, nor did it affect the survival rate of offspring to one year of age.[20]

Dispersal and survival[edit]

Red squirrel swimming

Juvenile American red squirrels must acquire a territory and midden prior to their first winter to survive. They can acquire a territory by competing for a vacant territory, creating a new territory or by receiving all or part of a territory from their mothers. This somewhat rare (15% of litters) female behavior is referred to as breeding dispersal or bequeathal, and is a form of maternal investment in offspring.[21] The prevalence of this behavior is related to the abundance of food resources and the age of the mother. In some cases, females will acquire additional middens prior to reproduction, which they later bequeath to their offspring.[22] Offspring that do not receive a midden from their mother typically settle within 150 m (3 territory diameters) of their natal territory.[21]

American red squirrels experience severe early mortality (on average only 22% survive to one year of age). The survival probability, however, increases to age three, when it begins to decrease again. Females that survive to one year of age have a life expectancy of 2.3 years and a maximum lifespan of eight years.

American red squirrels are preyed upon by Canadian lynx (Lynx canadensis), bobcat (Lynx rufus), coyote (Canis latrans), great horned owl (Bubo virginianus), northern goshawk (Accipiter gentilis), red-tailed hawk (Buteo jamaicensis), American crow (Corvus brachyrynchos), American marten (Martes americana), red fox (Vulpes vulpes), gray fox (Urocyon cinereoargenteus), wolf (Canis lupus) and weasel (Mustela sp.).[citation needed]

Gallery[edit]

See also[edit]

References[edit]

  1. ^ Linzey, A. V. & Hammerson, G. (2008). Tamiasciurus hudsonicus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 8 January 2009.
  2. ^ Thorington, R.W., Jr.; Hoffmann, R.S. (2005). "Family Sciuridae". In Wilson, D.E.; Reeder, D.M. Mammal Species of the World: a taxonomic and geographic reference (3rd ed.). The Johns Hopkins University Press. pp. 754–818. ISBN 0-8018-8221-4. OCLC 26158608. 
  3. ^ Goheen, J.R., R.K. Swihart, and J.H. Robins. 2003. The anatomy of a range expansion: changes in cranial morphology and rates of energy extraction for North American red squirrels from different latitudes. Oikos, 102: 33-44.
  4. ^ Woods, S. E. J. 1980. The Squirrels of Canada. National Museums of Canada
  5. ^ Mercer, J. M., and V. L. Roth. 2003. The effects of Cenozoic global change on squirrel phylogeny. Science 299:1568-1572.
  6. ^ a b c d Steele, M. A. 1998. Tamiasciurus hudsonicus. Mammalian Species 586:1-9.
  7. ^ Osgood, W. H. 1900. Results of a biological reconnaissance of the Yukon River region. General account of the region. Annotated list of mammals. Annotated list of birds. North American Fauna 19:1-100.
  8. ^ Arizona Game and Fish Department. 2003. Tamiasciurus hudsonicus grahamensis. Unpublished abstract compiled and edited by the Heritage Data Management System, Arizona Game and Fish Department, Phoenix, AZ. 5 pp. PDF
  9. ^ McAdam & Boutin unpub. data
  10. ^ Willson, Mary F.; De Santo, Toni L.; Sieving, Kathryn E. (July 2003). "Red squirrels and predation risk to bird nests in northern forests". Canadian Journal of Zoology 81 (7): 1202–1208. doi:10.1139/z03-096. 
  11. ^ Kelly, D. 1994. The evolutionary ecology of mast seeding. Trends in Ecology & Evolution 9:465-470.
  12. ^ Nienstaedt, H., and J. C. Zasada. 1990. Picea galuca (Moench) Voss white spruce. Pp. 165-185 in R. M. Burns and B. H. Honkala, eds. Silvics of North America. Vol. 1. Conifers. U.S. Department of Agriculture Agricultural Handbook.
  13. ^ Wernert, Susan J. (1982). Reader's Digest North American wildlife (2. pr. ed.). Pleasantville, NY [u.a.]: Reader's Digest Assoc. ISBN 0-89577-102-0. 
  14. ^ "The Rockies". Ray Mears' Extreme Survival.
  15. ^ "Red squirrel eating a Mushroom". Retrieved 2009-02-05. 
  16. ^ "Mushrooms cached by a red squirrel". Retrieved 2009-02-05. 
  17. ^ Layne, J. N. 1954. The biology of the red squirrel Tamiasciurus hudsonicus loquax in central New York. Ecological Monographs 24:227-267.
  18. ^ Millar, J. S. 1970. The breeding season and reproductive cycle of the western red squirrel. Canadian Journal of Zoology 48:471-473.
  19. ^ Lair, H. 1985. Length of gestation in the red squirrel, Tamiasciurus hudsonicus. Journal of Mammalogy 66:809-810.
  20. ^ Newswise: When It Comes to Female Red Squirrels, It Seems Any Male Will Do Retrieved on June 22, 2008.
  21. ^ a b Berteaux, D, and S. Boutin. 2000. Breeding dispersal in female North American red squirrels. Ecology, 81: 1311-1326.
  22. ^ Boutin, S., K.W. Larsen, and D. Berteaux. 2000. Anticipatory parental care: Acquiring resources for offspring prior to conception. Proceedings of the Royal Society of London, Series B, 267: 2081-2085.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Based on patterns of genetic variation and morphology, Arbogast et al. (2001) suggested that Tamiasciurus should be regarded as comprising one species with three subspecies (hudsonicus, douglasii [including mearnsi], and mogollonensis); mogollonensis represents a southwestern clade that occurs in Arizona, New Mexico, and adjacent parts of southern Colorado and southeastern Utah. Alternatively, Arbogast et al. (2001) suggested that these three taxa might be recognized as separate phylogenetic species. Pending further support for this rearrangement, the North American mammal checklist by Baker et al. (2003) did not accept Arbogast et al.'s (2001) proposed reorganization of Tamiasciurus as a single species. Thorington and Hoffmann (in Wilson and Reeder 2005) also recognized douglasii, hudsonicus, and mearnsi as distinct species.

Earlier, Hall (1981) had suggested that T. douglasii and T. hudsonicus might be conspecific, but Lindsay (1982) concluded that apparent hybrids probably were examples of character convergence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

red squirrel
pine squirrel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for the red squirrel is
Tamiasciurus hudsonicus Erxleben. There are 25 accepted subspecies [13].
  • 13. Flyger, Vagn; Gates, J. Edward. 1982. Pine squirrels: Tamiasciurus hudsonicus and T. douglasii. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 230-238. [25232]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!