Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Range Description

This species occurs from southeastern Tabasco and the southern Yucatan Peninsula, Mexico, south to northwestern Colombia (Patton 2005). It occurs in lowlands to 2,400 m (Reid 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Southern Mexican states Veracruz and Oaxaca, through Central America and south to Northwest Colombia. It is usually found at medium to high elevations (up to 2400 m), but on the Caribbean coast in Costa Rica and Panama it has been found near sea level.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length: 123-148 mm

Tail length: 133-196 mm

Hind foot length: 32-40 mm

Ear length: 16-20 mm

The forest spiny pocket mouse (Heteromys desmarestianus) is sexually dimorphic, with males typically weighing about one-third more than adult females. Size and weight also vary according to geographic location. They are smallest in East Panama and largest in the mountains of Costa Rica.

Heteromys desmarestianus has fur-lined, external pouches on either side of its mouth for temporarily storing and carrying food. The back, rump, and forearms are covered with stiff black-brown hair and peppered with interspersed cream-colored hairs. The sides are often paler black, and in dry lowlands some individuals may have a dusky-orange stripe on their sides. Ventral fur and feet are white. Their tail is bicolor with a black dorsal surface and a white ventral surface. The tail is sparsely haired, and usually about 20% longer than the head and body length, and may also have a white tip. Feet are long and narrow, and hind feet are naked. H. desmarestianus can be similar to other Heteromys species within some of its range, but can be differentiated by its dark forearms, hairless feet, and sparsely-haired tail.

Range mass: 46 to 87 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occurs in evergreen and semideciduous forest and good second growth. At low elevations it is usually found in mature, wet forest, and it favors areas with abundant palms (Reid 1997). It is seen on the ground in wet, lowlands forest at night.

This mouse makes burrows under tree roots or in open areas on the forest floor. Burrow entrances are usually vertical, unlike those of deer mice (Peromyscus spp.). Its nest is located in burrows or under logs. It feeds on palm nuts (Welfia georgii, Socratea durissima, Euterpe macrospadix, Geonoma sp., and Iriartea gigantean), other seeds (Meliosma spp., Pentaclethra macroloba, and Virola sebifera), fruit, and insects (Timm et al. 1989). Seeds may be stored in burrows or in caches above ground (Fleming 1983). Breeding occurs year-round, and a female have 5 litters per year. Litter size is usually 3. These mice live longer than many rodents of similar size, and some may survive 2 or 3 years in the wild (Fleming 1983; Reid 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

It is locally common in areas of wet rainforest, but it can also be found in areas of secondary growth or seasonally dry forest. In lowlands it is usually found in mature rainforest. H. desmarestianus favors habitat with abundant palms.

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Although H. desmarestianus eats some insects and fruits, it is mainly a granivore. In Costa Rica, its diet consisted mainly of palm nuts (Socratea durissima, Euterpe macrospadix, Welfia georgii, Geonoma sp., and Iriartea gigantea), and other seeds (Meliosma sp., Pentaclethra macroloba, and Viriola sebifera).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Heteromys desmarestianus breeds year-round, but during extended dry periods some males and females may become reproductively inactive. Sexually active males have noticeably enlarged scrotal testes. Sexually active females can have up to five litters per year, with an average litter size of three and an interval between pregnancies of two months or longer. Annual survivorship probabilities are greater than 20%, and some individuals may survive up to 3 years in the wild.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heteromys desmarestianus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA1826-08|EF156850|Heteromys desmarestianus| AACCGCTGACTCTTCTCTACTAACCACAAGGATATCGGTACTTTATACATAATCTTTGGTGCTTGAGCAGGCATAGTGGGGACTGGTTTA---AGCATCCTAATCCGAGCTGAATTAGGTCAACCTGGCTCCCTATTAGGAGAT---GATCAGATTTATAATGTAATTGTAACCGCACATGCTTTTGTAATAATCTTTTTTATAGTTATACCTATCATAATTGGGGGGTTTGGGAACTGATTAGTACCTTTAATA---ATTGGCGCTCCTGATATAGCATTCCCTCGAATAAACAATATGAGCTTTTGACTTCTCCCTCCCTCTTTCCTCCTCCTTTTAGCCTCTTCAATAGTTGAAGCAGGTGCTGGAACCGGGTGGACTGTATATCCTCCCCTTGCTGGAAACCTAGCCCACGCAGGAGCATCAGTTGACCTA---GCTATTTTTTCTCTTCACCTAGCTGGGGTATCTTCAATTCTTGGGGCTATTAACTTTATTACCACTATTATCAATATAAAACCACCTGCTATATCCCAATACCAGACACCCTTATTTGTCTGATCTGTTTTAATCACAGCTGTTCTCTTGCTACTATCCCTTCCCGTTCTAGCCGCT---GGCATTACTATACTTCTCACAGACCGAAACTTAAATACAACCTTTTTTGACCCTGCGGGAGGAGGTGACCCTATCCTATACCAACATTTATTCTGATTCTTCGGCCACCCTGAGGTCTACATCTTAATTTTACCTGGCTTCGGCATAATCTCCCACATTGTAACTTACTATTCAGGAAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGAGCCATAATATCCATTGGTTTCCTAGGTTTTATTGTATGAGCCCATCATATGTTTACGGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heteromys desmarestianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 226
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timm, R., McCarthy, T. & Samudio, R.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

H. desmarestianus has no special conservation status, but because it dwells in tropical forests it is negatively impacted by severe deforestation and non-forested agriculture. Currently it is still locally common in forested areas.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common and widespread (Reid 1997). Population density can reach 18 mice per hectare in suitable forest; individuals’ home ranges overlap extensively (Fleming 1983).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impacts have been reported or discussed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Because it is such an avid seed hoarder, H. desmarestianus is probably an important disperser of palm seeds and other large-seeded species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Desmarest's Spiny Pocket Mouse

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!