Overview
Comprehensive Description
Description
Athanas nitescens is a small shrimp measuring up to 2 cm in length. Its colour varies from green-blue, or red-brown, and can also be transparent and speckled with red chromatophores. The rostrum is well developed, straight, unarmed, projecting beyond segment one of antenna one, with an acutely pointed apex. Two anterior projections (bearing two lateral spines, and a small dorsal lobe) of the carapace particularly cover the eyes dorsally, hence the name hooded shrimp. The first pereiopod's (thoracic limbs) are larger than the second, symmetrical in females and predominantly asymmetrical in males. Females chelae are also slimmer than the males. The telson forming the tailfan with the uropods have two pairs of lateral spines, as well as an articulated process on pleonite six at the base of the uropods.This species is often found in groups of adults and juveniles. Ovigerous females occur from May through to September.
Trusted
Distribution
Azores, Azores Exclusive Economic Zone, Canary Islands, Cape Verde, Congo, East Atlantic, East Mediterranean, European waters (ERMS scope), Faial Island, FAO fishing area 34, FAO fishing area 47, Georgian Exclusive Economic Zone, Ionian sea, Irish Exclusive economic Zone, Israel, Israeli part of the Mediterranean Sea - Eastern Basin, Levantine Basin, Levantine Sea, Madeira, Mediterranean Sea, Netherlands, North East Coast of England , Oosterschelde, Sahara Coast, Scandinavia, South Africa (country), South Coast of England, South East Atlantic, South Scandinavia, Spain, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Coast of England, Wimereux, Yerseke
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
Species composition of meso- and macrozooplankton of the Black Sea
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=43140
-
L. B. Holthuis & E. Gottlies(1958) An annotated list of Decapod Crustacea of the Mediterranean Coast of Israel, with an appendix listing the Decapoda of the Eastern Mediterranean. Bulletin of the Research Council of Israel. Haifa, Israel. 1-126pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42367
-
Charles H.J.M. Fransen
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42308
-
Emmerson W.D. A comparison between decapod Species common to both Mediterranean and Southern African Waters.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42379
-
d'Udekem d'Acoz, C. (1999). Inventaire et distribution des crustacés décapodes de l'Atlantique nord-oriental, de la Méditerranée et des eaux continentales adjacentes au nord de 25°N [Inventory and distribution of the decapod crustaceans from the northeastern Atlantic, the Mediterranean and the adjacent continental waters north of 25°N]. Collection Patrimoines Naturels, 40. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-86515-114-10. X, 383 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1154
-
Hostens, K.; Mees, J.; Hummel, H. (2003). The mobile macro-invertebrate fauna of the Oosterschelde and the Westerschelde (SW Netherlands), in: Hostens, K. (2003). The demersal fish and macro-invertebrate assemblages of the Westerschelde and Oosterschelde estuaries (Southern Bight of the North Sea). pp. 87-103
http://www.marinespecies.org/ophiuroidea/aphia.php?p=sourcedetails&id=1144
-
Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284-292
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1392
-
D'Udekem d'Acoz C. & Wirtz P., (2000).Observations on some interesting coastal Crustacea Decapoda from the Azores, with a key to the genus Eualus Thallwitz, 1892 in the Northeastern Atlantic and the Mediterranean. Arquipélago, Life and Marine Sciences. Bull. Univ. of the Azores, 19A, 67-84.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42443
-
d'Udekem d'Acoz, C.; Faasse, M.; Dumoulin, E.; De Blauwe, H. (2005). Occurrence of the Asian shrimp Palaemon macrodactylus in the Southern Bight of the North Sea, with a key to the Palaemonidae of north-western Europe (Crustacea: Decapoda: Caridae). Ned. Faunist. Meded. 22: 95-111
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6828
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Galil, B.; Goren, M.; Mienis, H. (2011). Checklist of marine species in Israel. Compiled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149096
-
Holthuis, L.B., 1952a. Crustacés Décapodes, Macrures. [Crustacea Decapoda, Macrura]. Expédition océanographique belge dans les eaux côtières africaines de l'Atlantique Sud (1948-1949): résultats scientifiques, 3(2). Institut royal des Sciences naturelles de Belgique: Bruxelles, Belgium. 87 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42356
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
Trusted
Ecology
Habitat
Depth range based on 77 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.
Environmental ranges
Depth range (m): 0 - 267.5
Temperature range (°C): 7.556 - 18.117
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 18.622 - 38.605
Oxygen (ml/l): 5.358 - 6.427
Phosphate (umol/l): 0.088 - 0.546
Silicate (umol/l): 1.247 - 28.168
Graphical representation
Depth range (m): 0 - 267.5
Temperature range (°C): 7.556 - 18.117
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 18.622 - 38.605
Oxygen (ml/l): 5.358 - 6.427
Phosphate (umol/l): 0.088 - 0.546
Silicate (umol/l): 1.247 - 28.168
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 25 samples.
Environmental ranges
Depth range (m): 0 - 267.5
Temperature range (°C): 7.556 - 18.117
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 18.622 - 38.605
Oxygen (ml/l): 5.358 - 6.427
Phosphate (umol/l): 0.088 - 0.546
Silicate (umol/l): 1.247 - 28.168
Graphical representation
Depth range (m): 0 - 267.5
Temperature range (°C): 7.556 - 18.117
Nitrate (umol/L): 0.211 - 0.535
Salinity (PPS): 18.622 - 38.605
Oxygen (ml/l): 5.358 - 6.427
Phosphate (umol/l): 0.088 - 0.546
Silicate (umol/l): 1.247 - 28.168
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Found on the lower shore to depths 60 m, primarily beneath stones where the substratum is gravelly. Also found under algae.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Athanas nitescens
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 5 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACGCTATATTTTATTTTCGGAGCCTGAGCCGGGATATTAGGCACATCCCTCAGACTATTAATTCGAGCGGAGCTAGGACAACCAGGAAGCCTTATTGGAAATGATCAAATTTATAATGTAATTGTTACCGCCCATGCCTTTATTATGATTTTTTTTATAGTCATACCTATTATAATTGGAGGCTTCGGTAATTGACTGATCCCACTTATATTAGGTGCCCCGGACATAGCCTTTCCCCGGATGAATAACATAAGATTCTGGCTATTACCACCATCTCTCACGCTACTACTATCTAGAGGAATAGTAGAAAACGGGGTTGGAACAGGATGAACTGTATACCCCCCTCTGTCAACCAATATCGCACATGCAGGGGCCTCGGTGGACCTTGGTATTTTCTCTCTTCACCTGGCAGGAGTCTCTTCGATCCTAGGAGCTATTAACTTTATAACTACTGTTGCTAATATACAACCAGGTGGTGTAACTTTTGACCAACTATCTCTTTTCACCTGATCTGTCTTTCTCACAGCCATTTTACTCCTACTCTCCCTACCAGTCTTAGCGGGAGCAATTACAATACTTCTTACAGACCGAAACCTCAACACATCTTTCTTTGATCCTGCAGGAGGAGGAGACCCTATTCTCTACCAACACTTATTN
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Athanas nitescens
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Trusted
Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


