Overview

Comprehensive Description

Description

 Athanas nitescens is a small shrimp measuring up to 2 cm in length. Its colour varies from green-blue, or red-brown, and can also be transparent and speckled with red chromatophores. The rostrum is well developed, straight, unarmed, projecting beyond segment one of antenna one, with an acutely pointed apex. Two anterior projections (bearing two lateral spines, and a small dorsal lobe) of the carapace particularly cover the eyes dorsally, hence the name hooded shrimp. The first pereiopod's (thoracic limbs) are larger than the second, symmetrical in females and predominantly asymmetrical in males. Females chelae are also slimmer than the males. The telson forming the tailfan with the uropods have two pairs of lateral spines, as well as an articulated process on pleonite six at the base of the uropods.This species is often found in groups of adults and juveniles. Ovigerous females occur from May through to September.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores, Azores Exclusive Economic Zone, Canary Islands, Cape Verde, Congo, East Atlantic, East Mediterranean, European waters (ERMS scope), Faial Island, FAO fishing area 34, FAO fishing area 47, Georgian Exclusive Economic Zone, Ionian sea, Irish Exclusive economic Zone, Israel, Israeli part of the Mediterranean Sea - Eastern Basin, Levantine Basin, Levantine Sea, Madeira, Mediterranean Sea, Netherlands, North East Coast of England , Oosterschelde, Sahara Coast, Scandinavia, South Africa (country), South Coast of England, South East Atlantic, South Scandinavia, Spain, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, West Coast of England, Wimereux, Yerseke
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 77 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0 - 267.5
  Temperature range (°C): 7.556 - 18.117
  Nitrate (umol/L): 0.211 - 0.535
  Salinity (PPS): 18.622 - 38.605
  Oxygen (ml/l): 5.358 - 6.427
  Phosphate (umol/l): 0.088 - 0.546
  Silicate (umol/l): 1.247 - 28.168

Graphical representation

Depth range (m): 0 - 267.5

Temperature range (°C): 7.556 - 18.117

Nitrate (umol/L): 0.211 - 0.535

Salinity (PPS): 18.622 - 38.605

Oxygen (ml/l): 5.358 - 6.427

Phosphate (umol/l): 0.088 - 0.546

Silicate (umol/l): 1.247 - 28.168
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on the lower shore to depths 60 m, primarily beneath stones where the substratum is gravelly. Also found under algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Athanas nitescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCTATATTTTATTTTCGGAGCCTGAGCCGGGATATTAGGCACATCCCTCAGACTATTAATTCGAGCGGAGCTAGGACAACCAGGAAGCCTTATTGGAAATGATCAAATTTATAATGTAATTGTTACCGCCCATGCCTTTATTATGATTTTTTTTATAGTCATACCTATTATAATTGGAGGCTTCGGTAATTGACTGATCCCACTTATATTAGGTGCCCCGGACATAGCCTTTCCCCGGATGAATAACATAAGATTCTGGCTATTACCACCATCTCTCACGCTACTACTATCTAGAGGAATAGTAGAAAACGGGGTTGGAACAGGATGAACTGTATACCCCCCTCTGTCAACCAATATCGCACATGCAGGGGCCTCGGTGGACCTTGGTATTTTCTCTCTTCACCTGGCAGGAGTCTCTTCGATCCTAGGAGCTATTAACTTTATAACTACTGTTGCTAATATACAACCAGGTGGTGTAACTTTTGACCAACTATCTCTTTTCACCTGATCTGTCTTTCTCACAGCCATTTTACTCCTACTCTCCCTACCAGTCTTAGCGGGAGCAATTACAATACTTCTTACAGACCGAAACCTCAACACATCTTTCTTTGATCCTGCAGGAGGAGGAGACCCTATTCTCTACCAACACTTATTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Athanas nitescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!