Ecology

Habitat

Depth range based on 923 specimens in 31 taxa.
Water temperature and chemistry ranges based on 323 samples.

Environmental ranges
  Depth range (m): 0 - 4893.5
  Temperature range (°C): -1.917 - 24.371
  Nitrate (umol/L): 0.534 - 37.488
  Salinity (PPS): 31.738 - 36.735
  Oxygen (ml/l): 2.325 - 8.193
  Phosphate (umol/l): 0.118 - 2.426
  Silicate (umol/l): 1.193 - 128.514

Graphical representation

Depth range (m): 0 - 4893.5

Temperature range (°C): -1.917 - 24.371

Nitrate (umol/L): 0.534 - 37.488

Salinity (PPS): 31.738 - 36.735

Oxygen (ml/l): 2.325 - 8.193

Phosphate (umol/l): 0.118 - 2.426

Silicate (umol/l): 1.193 - 128.514
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Polymastia sp. WAMZ12384

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCAACAAATCATAAAGATATTGGGACTTTGTATTTGCTATTTGGGGCATTTGCAGGCATGATAGGAACGGGGTTTAGTATGCTTATTAGGTTAGAATTATCAGCTCCAGGTTCAATGCTTGGTGAT---GATCATTTATATAATGTTATAGTTACTGCTCATGCCTTTTTAATGATATTTTTTTTAGTTATGCCAGTGATGATAGGAGGGTTTGGGAATTGATTAGTTCCATTGTATATAGGATCTCCGGATATGGCTTTTCCTAGATTAAATAATATAAGTTTTTGATTATTGCCACCTTCTTTAACTTYATTATTAGGTTCGGCATTTGTAGAACAAGGGGCTGGTACAGGATGAACGGTATACCCCCCTTTAGCAAGTATACAGGCACACTCCGGTGGGTCAGTAGATATGGCAATATTTAGTTTGCATTTGGCGGGGATTTCTTCTATATTGGGTGCAATGAATTTTATTACTACAATATTTAATATGAGAGCTCCGGGCATAACAATGGATCGAATGCCGTTATTTGTATGATCAATATTAATAACTGCTTTCTTATTATTATTATCTTTACCTGTGTTGGCAGGGGCTATTACGATGCTTCTTACAGATAGGAACTTTAATACTGCCTTTTTTGATCCAGCAGGGGGAGGCGATCCTATCTTATATCAACATCTTTTCTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Polymastia sp. WAMZ12384

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Polymastia sp. WAMZ3927

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCAACAAATCATAAAGATATTGGGACTCTTTATTTATTGTTAGGGGCCTTTGCAGGGATGATCGGAACAGCCTTTAGTATGCTAATTAGGCTAGAATTGTCGGCCCCTGGTTCAATGTTAGGTGAC---GACCATCTGTATAATGTTATAGTTACTGCTCACGCATTTGTGATGATATTTTTTGTTGTTATGCCAGTAATGATTGGGGGGTTTGGAAACTGACTGGTTCCATTATATATTGGAGCGCCTGATATGGCATTTCCAAGATTAAATAATATTAGTTTTTGGCTATTGCCCCCTTCTTTAACCCTATTATTAGGTTCGGCTTTCGTTGAACAAGGGGCGGGGACTGGATGAACGGTCTATCCTCCTCTATCAAGCATACAAACACATTCAGGGGGGTCGGTGGATATGGTTATATTTAGTTTACATTTGGCAGGGATTTCGTCAATATTGGGGGCAATGAATTTCATTACAACAATCTTTAATATGAGAGCGCCCGGAATTACCTTGGATAGAATGCCACTATTTGTGTGATCTATTTTAGTTACAGCTTTCTTATTATTATTGTCTTTACCAGTATTGGCGGGGGCCATAACAATGCTTCTTACAGACCGAAACTTTAATACCACATTCTTTGATCCGGCTGGGGGTGGTGACCCGATTTTATATCAACACTTATTCTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Polymastia sp. WAMZ3927

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:5Public Records:2
Specimens with Sequences:2Public Species:2
Specimens with Barcodes:2Public BINs:2
Species:4         
Species With Barcodes:2         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Polymastia

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Polymastia (sponge)

Polymastia is a genus of sponges (Porifera) containing about 30 species. These are small to large encrusting or dome-shaped sponges with a smooth surface having many teat-shaped projections (papillae). In areas of strong wave action, this genus does not grow the teat structures, but instead grows in a corrugated form.[1]

The image depicts Polymastia pachymastia, often called "aggregated nipple sponge", a species found off the coast of northern California.[2]

Its species include:

References

  1. ^ Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E. 2010. Two Oceans: a guide to the marine life of southern Africa ISBN 978-1-77007-772-0
  2. ^ "Polymastia pachymastia de Laubenfels, 1932". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=170652.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!