Ecology
Habitat
Depth range based on 923 specimens in 31 taxa.
Water temperature and chemistry ranges based on 323 samples.
Environmental ranges
Depth range (m): 0 - 4893.5
Temperature range (°C): -1.917 - 24.371
Nitrate (umol/L): 0.534 - 37.488
Salinity (PPS): 31.738 - 36.735
Oxygen (ml/l): 2.325 - 8.193
Phosphate (umol/l): 0.118 - 2.426
Silicate (umol/l): 1.193 - 128.514
Graphical representation
Depth range (m): 0 - 4893.5
Temperature range (°C): -1.917 - 24.371
Nitrate (umol/L): 0.534 - 37.488
Salinity (PPS): 31.738 - 36.735
Oxygen (ml/l): 2.325 - 8.193
Phosphate (umol/l): 0.118 - 2.426
Silicate (umol/l): 1.193 - 128.514
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 323 samples.
Environmental ranges
Depth range (m): 0 - 4893.5
Temperature range (°C): -1.917 - 24.371
Nitrate (umol/L): 0.534 - 37.488
Salinity (PPS): 31.738 - 36.735
Oxygen (ml/l): 2.325 - 8.193
Phosphate (umol/l): 0.118 - 2.426
Silicate (umol/l): 1.193 - 128.514
Graphical representation
Depth range (m): 0 - 4893.5
Temperature range (°C): -1.917 - 24.371
Nitrate (umol/L): 0.534 - 37.488
Salinity (PPS): 31.738 - 36.735
Oxygen (ml/l): 2.325 - 8.193
Phosphate (umol/l): 0.118 - 2.426
Silicate (umol/l): 1.193 - 128.514
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Polymastia sp. WAMZ12384
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TCAACAAATCATAAAGATATTGGGACTTTGTATTTGCTATTTGGGGCATTTGCAGGCATGATAGGAACGGGGTTTAGTATGCTTATTAGGTTAGAATTATCAGCTCCAGGTTCAATGCTTGGTGAT---GATCATTTATATAATGTTATAGTTACTGCTCATGCCTTTTTAATGATATTTTTTTTAGTTATGCCAGTGATGATAGGAGGGTTTGGGAATTGATTAGTTCCATTGTATATAGGATCTCCGGATATGGCTTTTCCTAGATTAAATAATATAAGTTTTTGATTATTGCCACCTTCTTTAACTTYATTATTAGGTTCGGCATTTGTAGAACAAGGGGCTGGTACAGGATGAACGGTATACCCCCCTTTAGCAAGTATACAGGCACACTCCGGTGGGTCAGTAGATATGGCAATATTTAGTTTGCATTTGGCGGGGATTTCTTCTATATTGGGTGCAATGAATTTTATTACTACAATATTTAATATGAGAGCTCCGGGCATAACAATGGATCGAATGCCGTTATTTGTATGATCAATATTAATAACTGCTTTCTTATTATTATTATCTTTACCTGTGTTGGCAGGGGCTATTACGATGCTTCTTACAGATAGGAACTTTAATACTGCCTTTTTTGATCCAGCAGGGGGAGGCGATCCTATCTTATATCAACATCTTTTCTGATTTTTTGGTCACCCTGAAGTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Polymastia sp. WAMZ12384
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Polymastia sp. WAMZ3927
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TCAACAAATCATAAAGATATTGGGACTCTTTATTTATTGTTAGGGGCCTTTGCAGGGATGATCGGAACAGCCTTTAGTATGCTAATTAGGCTAGAATTGTCGGCCCCTGGTTCAATGTTAGGTGAC---GACCATCTGTATAATGTTATAGTTACTGCTCACGCATTTGTGATGATATTTTTTGTTGTTATGCCAGTAATGATTGGGGGGTTTGGAAACTGACTGGTTCCATTATATATTGGAGCGCCTGATATGGCATTTCCAAGATTAAATAATATTAGTTTTTGGCTATTGCCCCCTTCTTTAACCCTATTATTAGGTTCGGCTTTCGTTGAACAAGGGGCGGGGACTGGATGAACGGTCTATCCTCCTCTATCAAGCATACAAACACATTCAGGGGGGTCGGTGGATATGGTTATATTTAGTTTACATTTGGCAGGGATTTCGTCAATATTGGGGGCAATGAATTTCATTACAACAATCTTTAATATGAGAGCGCCCGGAATTACCTTGGATAGAATGCCACTATTTGTGTGATCTATTTTAGTTACAGCTTTCTTATTATTATTGTCTTTACCAGTATTGGCGGGGGCCATAACAATGCTTCTTACAGACCGAAACTTTAATACCACATTCTTTGATCCGGCTGGGGGTGGTGACCCGATTTTATATCAACACTTATTCTGATTTTTTGGTCACCCTGAAGTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Polymastia sp. WAMZ3927
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 5 | Public Records: | 2 |
| Specimens with Sequences: | 2 | Public Species: | 2 |
| Specimens with Barcodes: | 2 | Public BINs: | 2 |
| Species: | 4 | ||
| Species With Barcodes: | 2 | ||
© Barcode of Life Data Systems
Trusted
Barcode data
© Barcode of Life Data Systems
Trusted
Locations of barcode samples
© Barcode of Life Data Systems
Trusted
Wikipedia
Polymastia (sponge)
Polymastia is a genus of sponges (Porifera) containing about 30 species. These are small to large encrusting or dome-shaped sponges with a smooth surface having many teat-shaped projections (papillae). In areas of strong wave action, this genus does not grow the teat structures, but instead grows in a corrugated form.[1]
The image depicts Polymastia pachymastia, often called "aggregated nipple sponge", a species found off the coast of northern California.[2]
Its species include:
References
- ^ Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E. 2010. Two Oceans: a guide to the marine life of southern Africa ISBN 978-1-77007-772-0
- ^ "Polymastia pachymastia de Laubenfels, 1932". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=170652.
- North East Atlantic Taxa
- Michelle Kelly-Borges & Patricia R. Bergquist (1997). "Revision of Southwest Pacific Polymastiidae (Porifera: Demospongiae: Hadromerida) with descriptions of new species of Polymastia Bowerbank, Tylexocladus Topsent, and Acanthopolymastia gen. nov. from New Zealand and the Norfolk Ridge, New Caledonia". New Zealand Journal of Marine and Freshwater Research 31 (3): 367–402. doi:10.1080/00288330.1997.9516772. http://www.rsnz.org/publish/nzjmfr/1997/32.pdf.
 | This poriferan- (or sponge-) related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
![[1]](http://www.imagequest3d.com/cgi-bin/ImageFolio4/imageFolio.cgi?action=view&link=aquatic/porifera&image=JMG00329.jpg&img=&tt=){kind=link}
