Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Distribution

Atlantic Europe, Baltic sea, Belgian Coast, Belgian Exclusive Economic Zone, Belt Sea, Black Sea, Caspian Sea, Dutch Exclusive Economic Zone, Elbe, European waters (ERMS scope), France, German Bight, German Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Mediterranean Sea, Netherlands, North Sea, North West Atlantic, Pacific Coast of the United States, Portugal, Spain, Swedish Exclusive Economic Zone, Tunis Gulf, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Miramichi estuary, New Brunswick to Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brackish water species.
  • Adema, J.P.H.M. (1991). De krabben van Nederland en Belgie (Crustacea, Decapoda, Brachyura) [The crabs of the Netherlands and Belgium (Crustacea, Decapoda, Brachyura)]. Nationaal Natuurhistorisch Museum: Leiden, The Netherlands. ISBN 90-73239-02-8. 244 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=51 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North-east American, brackish water, species introduced into south Baltic, Dutch and other European estuaries, and particularly docks warmed by power station effluents, e.g. Swansea and Southampton.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 255 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): -99 - 42.7
  Temperature range (°C): 10.067 - 24.436
  Nitrate (umol/L): 0.457 - 16.868
  Salinity (PPS): 31.982 - 36.080
  Oxygen (ml/l): 4.807 - 6.636
  Phosphate (umol/l): 0.100 - 0.890
  Silicate (umol/l): 0.805 - 11.419

Graphical representation

Depth range (m): -99 - 42.7

Temperature range (°C): 10.067 - 24.436

Nitrate (umol/L): 0.457 - 16.868

Salinity (PPS): 31.982 - 36.080

Oxygen (ml/l): 4.807 - 6.636

Phosphate (umol/l): 0.100 - 0.890

Silicate (umol/l): 0.805 - 11.419
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The dwarf crab or Zuiderzee crab Rhithropanopeus harrisii originally only occurred along the east coast of America, but came to Europe through ship transport. The first European observations date from 1874, in the Netherlands. In Belgium, the first living specimens of the dwarf crab were encountered in 1991, in the Sea Scheldt near Antwerp. This crab is a typical species for fresh and brackish waters and is comfortable in estuaries. It is a predator of several types of invertebrates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhithropanopeus harrisii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 183 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTACATTATATTTTATTTTTGGAGCATGAGCTGGTATAGTAGGAACCTCATTAAGTTTAATTATTCGAGCTGAACTAGGTCAACCTGGTACCCTCATTGGTAATGACCAAATTTACAATGTTGTAGTAACAGCTCACGCCTTTGTAATAATCTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGACTAGTTCCATTAATATTAGGAGCCCCTGATATAGCGTTTCCTCGTATAAATAATATAAGATTCTGACTTTTACCACCATCACTTACACTCCTCCTAATAAGAGGAATAGTAGAAAGAGGAGTTGGAACAGGATGAACTGTATACCCTCCTTTAGCTGCTGCTATTGCTCATGCAGGAGCCTCCGTTGATATAGGAATCTTCTCCTTACATTTAGCAGGTGTTTCTTCTATTTTAGGTGCCGTTAATTTTATAACAACCGTAATTAATATACGATCATTTGGTATAACTATAGACCAAATACCATTATTTGTTTGAGCAGTATTTATTACTGCTATTTTGTTACTTTTATCTTTACCTGTATTAGCTGGAGCCATTACTATACTTTTAACTGATCGTAATTTAAATACCTCATTTTTCGACCCTGCTGGAGGAGGAGACCCTGTCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhithropanopeus harrisii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 184
Specimens with Barcodes: 184
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhithropanopeus harrisii

Rhithropanopeus harrisii (common names include the Zuiderzee crab,[2] dwarf crab,[2] estuarine mud crab,[3] Harris mud crab,[3] and white-tipped mud crab), is a small omnivorous crab native to Atlantic coasts of the Americas, from New Brunswick to northern Brazil.[2]

R. harrisii is usually found in brackish water, but can also be found in freshwater. It likes to live on stones and in oyster beds. The crab can reach a maximum size of 20 millimetres (0.8 in). It has an olive-green-brownish color, sometimes with dark spots on its carapace.

It is a common inhabitant of Texas and Florida estuaries, but was later introduced all over the world.[3] In 1937, it was discovered to be invading the San Francisco Bay's brackish waters and adjacent fresh waters of the California Central Valley.[3] It was also recently discovered in the Third Lock Lake in Panama, a man-made lake intended to be a part of the Panama Canal.[4]

R. harrisii was first discovered in Europe in the Zuider Zee, the Netherlands, and is now also found in Denmark, Belgium, Germany, France, Poland, Russia, Romania and Bulgaria, from the Black Sea and Caspian Sea.[2] In the British Isles, R. harrisii has only been observed in Roath Docks, Cardiff, which have lower salinity (12) than the surrounding waters.

Breeding freshwater populations have been found in the Brazos River basin in Texas, notably the Possum Kingdom State Park and Lake Granbury. Populations have also been discovered in Lake Texoma.[5]

References

  1. ^ a b P. K. L. Ng, D. Guinot & P. J. F. Davie (2008). "Systema Brachyurorum: Part I. An annotated checklist of extant Brachyuran crabs of the world". Raffles Bulletin of Zoology 17: 1–286. http://rmbr.nus.edu.sg/rbz/biblio/s17/s17rbz.pdf.
  2. ^ a b c d Dr C. Mettam & P. F. Clark. "Rhithropanopeus harrisii". Joint Nature Conservation Committee. http://www.jncc.gov.uk/page-1710. Retrieved December 10, 2009.
  3. ^ a b c d Harriet Perry (April 24, 2006). "Rhithropanopeus harrisii (Gould, 1841)". http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=197.
  4. ^ Dominique G. Roche & Mark E. Torchin (2007). "Established population of the North American Harris mud crab, Rhithropanopeus harrisii (Gould 1841) (Crustacea: Brachyura: Xanthidae) in the Panama Canal". Aquatic Invasions 2 (3): 155–161. doi:10.3391/ai.2007.2.3.1. http://www.aquaticinvasions.net/2007/AI_2007_2_3_Roche_Torchin.pdf.
  5. ^ Terrence Boyle, Jr., Donald Keith & Russell Pfau (2010). "Occurrence, reproduction, and population genetics of the estuarine mud crab, Rhithropanopeus harrisii (Gould) (Decapoda, Panopidae) in Texas freshwater reservoirs". Crustaceana 83 (4): 493–505. doi:10.1163/001121610X492148.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!