Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit surge-swept shorelines and seaward reef margins. Juveniles often occur in pockets of the intertidal reef crest, while adults are found in ridges between surge channels (Ref. 1602). Feed on benthic algae. Juveniles found in sheltered ocean bays, shallow low boulder-reefs above sand level. Known in clear-water reefs in gutters and upper edge of drop-offs (Ref. 9002). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Marshall and Pitcairn island groups, north to Japan, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa east to Marquesas Islands and Pitcairn Group, north to southern Japan, south to Western Australia, New South Wales (Australia), Lord Howe Island, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 15 - 17; Analspines: 2; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 4391))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Juveniles have a conspicuous dorsal ocellus behind a wide white band. Large adults are uniformly dirty bronze.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Plectroglyphidodon leucozonus
Catalog Number: USNM 61678
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): B. Corney
Locality: Suva, Fiji, Fiji, Fiji Islands, Pacific
  • Holotype: Jordon & Dickerson. 1908. Proceedings of the United States National Museum. 34 (1625): 613.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 6 m (Ref. 9002)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 73 specimens in 1 taxon.
Water temperature and chemistry ranges based on 50 samples.

Environmental ranges
  Depth range (m): 0.5 - 150
  Temperature range (°C): 23.208 - 29.061
  Nitrate (umol/L): 0.016 - 0.800
  Salinity (PPS): 33.821 - 35.383
  Oxygen (ml/l): 4.450 - 4.940
  Phosphate (umol/l): 0.103 - 0.284
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.5 - 150

Temperature range (°C): 23.208 - 29.061

Nitrate (umol/L): 0.016 - 0.800

Salinity (PPS): 33.821 - 35.383

Oxygen (ml/l): 4.450 - 4.940

Phosphate (umol/l): 0.103 - 0.284

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 4m.
Recorded at 4 meters.

Habitat: reef-associated. Sash damsel.  (Bleeker, 1859) Attains 12 cm. A widespread species recognised by its overall brown colour and pale vertical bar across the mid-body. This bar is often missing in mature specimens. Some blue marks on scales behind and beneath the eye. Juveniles with a large yellow-edged black spot basally in rear spinous portion of dorsal fin and a small black spot on upper portion of caudal peduncle. Inhabits rocky shores and reef flats exposed to wave action in 0 - 4 metres. Feeds predominantly on benthic algae. Very territorial and guards its territory aggressively. Tropical Indo-West Pacific south to Transkei. Common in Durban area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Plectroglyphidodon leucozonus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Plectroglyphidodon leucozonus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCCTCCTCATTCGGGCAGAACTTAGCCAACCAGGCGCCCTCCTCGGAGACGACCAGATTTATAATGTCATTGTTACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGACTCATTCCCCTCATGATCGGAGCGCCTGATATGGCCTTTCCCCGGATGAACAACATGAGCTTTTGACTCCTTCCCCCCTCATTTCTTCTTCTACTTGCCTCTTCCGGTGTTGAAGCGGGGGCAGGAACAGGATGAACTGTTTATCCTCCTCTATCCGGAAACCTTGCCCACGCAGGTGCATCCGTCGACCTAACCATCTTCTCCCTTCACTTAGCGGGGATTTCCTCTATTCTCGGGGCAATCAACTTCATTACTACAATTATTAATATGAAACCGCCTGCTATCTCCCAGTACCAAACACCGCTCTTCGTATGAGCCGTGTTAATTACTGCCGTCCTTCTACTCCTATCCCTCCCAGTTCTGGCCGCCGGGATTACTATACTTCTTACCGATCGAAACCTAAACACCACATTCTTTGATCCTGCAGGCGGTGGAGATCCAATTCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!