Overview

Comprehensive Description

Biology

Found in deep waters (Ref. 10713). May occur in crevices of steep drop-offs in as little as 25 m (Ref. 37816). Benthic (Ref. 58302).
  • Randall, J.E. and D. Golani 1995 Review of the moray eels (Anguilliformes: Muraenidae) of the Red Sea. Bull. Mar. Sci. 56(3):849-880. (Ref. 10713)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to Samoa, north to the Ogasawara Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and western Mascarenes east to Hawaiian Islands and Society Islands, north to Ogasawara Islands, south to Samoa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 141
  • Castle, P.H.J. and J.E. McCosker 1986 Muraenidae. p. 165-176. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3257)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 647 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

64.7 cm TL (male/unsexed; (Ref. 10713))
  • Randall, J.E. and D. Golani 1995 Review of the moray eels (Anguilliformes: Muraenidae) of the Red Sea. Bull. Mar. Sci. 56(3):849-880. (Ref. 10713)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found in deep waters.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Greenish with yellowish spots; brown stripe from chin to anus and alongside anal.
  • Castle, P.H.J. and J.E. McCosker 1986 Muraenidae. p. 165-176. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 3257)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Gymnothorax goldsboroughi Jordan & Evermann
Catalog Number: USNM 50617
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type: Jordan, D. S. & Evermann, B. W. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 167.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 92 - 450 m (Ref. 37816)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 150 - 150
  Temperature range (°C): 23.843 - 23.843
  Nitrate (umol/L): 0.996 - 0.996
  Salinity (PPS): 36.101 - 36.101
  Oxygen (ml/l): 4.415 - 4.415
  Phosphate (umol/l): 0.305 - 0.305
  Silicate (umol/l): 1.140 - 1.140
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 92 - 300m.
From 92 to 300 meters.

Habitat: demersal. Found in deep waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax elegans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCTCTATTTAGTATTTGGTGCCTGGGCCGGGATGGTCGGTACCGCATTGAGCCTTCTTATCCGGGCTGAACTTAGCCAACCCGGCGCTCTTTTAGGAGACGACCAGATTTATAACGTTATCGTAACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATACCTGTAATAATTGGAGGCTTCGGAAACTGGCTAATTCCCTTAATAATTGGAGCCCCTGACATGGCCTTCCCACGGATAAATAACATAAGCTTTTGACTACTTCCTCCCTCTTTTCTTCTGCTCTTAGCCTCTTCTGGGGTTGAGGCCGGGGCAGGGACAGGATGAACTGTCTATCCACCCCTTGCAGGGAACCTTGCACATGCCGGGGCTTCTGTTGATTTAACTATTTTTTCTCTTCACCTAGCTGGGGTGTCTTCAATCTTAGGGGCAATTAACTTTATTACAACAATCATTAATATGAAACCACCAGCCATCACGCAATACCAAACCCCTTTATTTGTATGAGCGGTGTTAGTAACAGCGGTGCTTCTCCTGCTCTCCCTTCCAGTCTTAGCGGCTGGCATTACGATACTTCTAACCGATCGAAATCTTAACACCACTTTCTTTGACCCTGCTGGAGGAGGTGACCCGATCCTTTATCAACACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax elegans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gymnothorax elegans

The elegant moray or Goldsborough's moray eel,[1] Gymnothorax elegans, is a moray eel found in coral reefs in the Pacific and Indian Oceans.[2] It was first named by Bliss in 1883.[2]

References[edit]

  1. ^ Common names for Gymnothorax elegans at www.fishbase.org.
  2. ^ a b Gymnothorax elegans at www.fishbase.org.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!