Articles on this page are available in 2 other languages: Arabic (13), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits mud flats of turbid inner reefs and mangroves and sandy lagoons (Ref. 9710). Benthopelagic in shallow, coastal areas (Ref. 58302). Grabs food from the substratum using its snout. Can tolerate oxygen poor water by inhaling air into a lung-like air bladder (Ref. 9710). Migrates to mass spawn at seaward mouths of channels on lunar cycle (Ref. 9710). Sold fresh in markets but seldom used for human consumption.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Shortjaw Bonefish occurs from Hawaii and French Polynesia to the Seychelles in the western Indian Ocean, north to southern Japan and south to Lord Howe Island, Australia. Its type locality is in the Red Sea (Bowen et al. 2008). Reflecting results in Colborn et al. (2001), the geographic range of A. glossodonta is likely representative of multiple species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to the Hawaiian and Tuamoto Islands, north to southern Japan, south to Lord Howe Island, Australia; throughout Micronesia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands, north to southern Japan and Ogasawara Islands, south to New Caledonia and Lord Howe Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 19; Analspines: 0; Analsoft rays: 8 - 9
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 900 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

90.0 cm SL (male/unsexed; (Ref. 1602)); max. published weight: 8,610 g (Ref. 5450)
  • Bouhlel, M. 1988 Poissons de Djibouti. Placerville (California, USA): RDA International, Inc. 416 p. (Ref. 5450)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Look up in FishBase
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tip of lower jaw broadly rounded; a spot of black pigment often present on the underside of snout, at least in smaller individuals; tooth patches on parasphenoid and basibranchial bones more broadly oval in shape, average width/length 0.38 and 0.45, respectively; number of teeth in pharyngobranchial tooth patch usually 5-15 (Ref. 9828). Compared to A. argentea which has a yellow spot on the axil of the pectoral fin, in this species, there is none (Ref. 74924).
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found on shallow flats, sandy bottoms, seagrass beds, mangrove shorelines and reef and rubble habitats. Like A. vulpes, A. glossodonta may be closely associated with mangroves and seagrasses and other shallow coastal habitats. Valiela et al. (2001) estimates that mangroves have decreased worldwide by 35%, at a rate of 2% per year. Using this estimate, mangroves have declined global by an estimated 27% over the last three generation lengths for A. glossodonta (13.5 years). Much of this species' distribution lies in the Indo-Pacific, where up to 14% of mangrove species are listed as threatened (Vulnerable, Endangered, or Critically Endangered) in some places (Polidoro et al. 2010). The Indo-Malay Philippine Archipelago is of particular concern, as it has one of the highest rates of mangrove loss globally, with an estimated 30% reduction in mangrove area since 1980 (FAO 2007). In the tropical Indo-Pacific, 12% of all seagrasses are currently threatened, and 20% of all seagrass species are experiencing declines. In the temperate North Pacific, the northern-most part of A. glossodonta's range, 22% of all seagrass species are threatened, and 44% are experiencing population declines (Short et al. 2011). Given the declines in these habitats, we infer that the extreme habitat loss in parts of its Pacific range will have similar negative consequences for population trajectories.

Larvae of A. glossodonta are morphologically indistinguishable from A. argentea (then listed as A. forsteri) (Friedlander et al. 2008). Mean larval stage is 56 days (Friedlander et al. 2008). Maximum age recorded is 11 years (Friedlander et al. 2008). Sex ratio varies widely across its distribution (1 to 1.25 in a study by Friedlander and 1–6.75 in another (Beets 2000). Although minimum size and age at maturity is not known, Albula sp. reared in the lab were sexually mature at two and three years of age (Pfeiler et al. 2000). Using equation number five of section 4.4 of the Guidelines for Using the IUCN Red List Categories and Criteria (IUCN Standards and Petitions Working Group 2008), if generation length = age of first reproduction + z*(length of the reproductive period), and age at first reproduction is estimated at 2.5 years, z is estimated to be 0.5 based on survivorship and relative fecundity with age, and the length of the reproductive period is estimated at 8.5 years, then generation length is estimated to be 4.5 years.

This species primarily feeds on crustaceans, including mantis shrimps and crab, also polychaetes, bivalves and amphipods (Friedlander 1997). Crustaceans comprised more than 50% of the diet in a Hawaiian study (Friedlander 1997).

Natural mortality from sharks is very high at Palmyra Atoll (Adams pers. comm. 2011). The maximum size for this species is 90 cm (SL) (Myers 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Albula glossodonta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGGCAATTACTCGATGGTTCTTTTCCACTAACCACAAAGATATCGGTACCCTCTATTTAGTGTTCGGCGCTTGGGCCGGAATGGTGGGTACAGCTTTGAGTCTCCTAATCCGGGCGGAGCTAAGTCAGCCCGGGGCTTTGTTGGGGGATGATCAAATTTACAATGTTATTGTTACAGCGCATGCTTTTGTAATGATTTTCTTTATAGTGATGCCGATCTTGATCGGTGGGTTTGGTAACTGGCTTGTCCCACTTATGATTGGGGCGCCGGATATGGCGTTTCCTCGTATGAATAATATGAGTTTCTGATTGCTACCCCCCTCGTTCCTGCTTCTTCTAGCTTCTTCTGGGGTTGAAGCGGGGGCTGGGACGGGGTGGACGGTTTATCCTCCTCTTTCTGGGAATTTGGCTCATGCTGGGGCGTCGGTAGACTTGACTATCTTCTCTCTACATCTTGCAGGTGTCTCTTCAATCCTTGGGGCTATCAATTTTATTACTACAATTATTAATATGAAGCCTCCTGCTATTTCCCAGTATCAGACTCCTTTATTTGTTTGGTCTGTCCTGGTGACCGCAGTTCTCTTGCTGTTGTCTTTGCCTGTCCTGGCTGCAGGTATTACTATGCTTCTGACTGACCGTAATCTCAACACCACTTTCTTTGACCCGGCGGGAGGAGGGGATCCTATTTTATATCAGCACTTGTTTTGGTTCTTCGGTCATCCTGAGGTTTATATTCTTATTCTCCCAGGGTTTGGTATGATCTCACACATTGTTGCTTACTATTCTGGCAAGAAGGAGCCTTTCGGTTATATGGGGATGGTTTGGGCTATGATGGCCATTGGCCTTCTTGGTTTCATTGTTTGGGCCCATCATATGTTTACTGTTGGGATGGATGTAGATACTCGTGCTTATTTTACTTCTGCTACGATAATTATTGCTATTCCTACTGGGGTAAAGGTGTTCAGTTGATTGGCTACTCTGCATGGTGGCTCTATTAAATGGGACACGCCATTGCTTTGAGCCCTTGGGTTTATTTTCTTGTTCACAGTAGGGGGGTTGACAGGGATTATCTTGTCTAATTCTTCTCTGGACATTGTTCTTCATGACACTTACTATGTGGTAGCTCATTTCCATTATGTCCTTTCCATGGGGGCTGTGTTTGCTATCATGGGCGGGTTTGTGCATTGATTCCCTCTTTTCACTGGTTATACTCTTCATAGTACTTGGACTAAAATCCATTTTGGAGTGATGTTTGTTGGGGTGAATGTTACTTTCTTCCCTCAGCATTTCCTCGGGCTAGCTGGAATGCCTCGTCGGTACTCTGATTATCCGGATGCGTATACCTTGTGAAACACTGTGTCTTCAATTGGGTCTCTTATCTCTCTTGTGGCTGTAATCATGTTCTTGTTCATTCTGTGGGAGGCCTTCGCTGCTAAGCGAGAGGTTCTCTCTGTGGAGTTGGCAGAAAACAATGTGGAGTGATTGCACGGCTGCCCTCCTCCATATCACACATTTGAAGAGCCAGCTTTTGTTCAAGTTCAGTCTAACTATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Albula glossodonta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bcd

Version
3.1

Year Assessed
2012

Assessor/s
Adams, A., Guindon, K., Horodysky, A., MacDonald, T., McBride, R., Shenker, J. & Ward, R.

Reviewer/s
Harwell, H. & Raynal, M.

Contributor/s

Justification
The Shortjaw Bonefish occurs from Hawaii and French Polynesia to the Seychelles in the western Indian Ocean, north to southern Japan and south to Lord Howe Island, Australia. Reflecting results in Colborn et al. (2001), the geographic range of A. glossodonta is likely representative of multiple species. Data on population decline are available from only a few locations, despite the expansive geographic range. In Tarawa, there has been a dramatic increase in scale of effort and modernization of the fishing gears. In 1977, bonefish comprised 44.6% of the total catch; in 1992, they comprised only 7.5% of the total catch. This decline (37.1% in 15 years) was a result of overfishing, as opposed to a change in fishing method and effort (Beets 2000). Spawning aggregations are often targeted (Beets 2000). In Tarawa Lagoon, Kiribati, recent studies have demonstrated significant declines in abundance and average size of bonefish in the catch between 1977 and the late 1990s. Given fisheries characteristics throughout the region, we expect that in areas where bonefish are exposed to fishing effort that Tarawa serves as an example of what would likely occur in other areas throughout its range. In addition, although data on population decline is limited, this species may be closely associated with mangroves and seagrasses and other shallow coastal habitats. Valiela et al.(2001) estimate that mangroves have decreased worldwide by 35%, at a rate of 2% per year. Using this estimate, mangroves have declined global by an estimated 27% over the last three generation lengths for A. glossodonta (13.5 years). Much of this species' distribution lies in the Indo-Pacific, where up to 14% of mangrove species are listed as threatened (Vulnerable, Endangered, or Critically Endangered) in some places (Polidoro et al. 2010). The Indo-Malay Philippine Archipelago is of particular concern, as it has one of the highest rates of mangrove loss globally, with an estimated 30% reduction in mangrove area since 1980 (FAO 2007). In the tropical Indo-Pacific, 12% of all seagrasses are currently threatened, and 20% of all seagrass species are experiencing declines. In the temperate North Pacific, the northern-most part of A. glossodonta's range, 22% of all seagrass species are threatened, and 44% are experiencing population declines (Short et al. 2011). Given the declines in these habitats, we infer that the extreme habitat loss in parts of its Pacific range will have similar negative consequences for population trajectories. In addition, the recreational fishery is not well-established in the Indo-Pacific region, so there is little economic incentive for conservation; we do not expect conservation to be occurring at present. Therefore, we estimate global decline to equal or exceed 30% over three generation lengths in the past (13.5 years), with some substantially greater localized depletions in parts of the Indo-Pacific. Perhaps the greatest hindrances to the global conservation of this species are uncertainties about population connectivity and taxonomic resolution. This species is currently listed as Vulnerable under A2bcd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
As multiple species within the genus are morphologically indistinguishable, there is limited species-specific information available on population status. Commercial landings of bonefish in Hawaii have declined from over 136.4 mt in 1900 to only 1.2 mt in 2001. This figure, however, includes all bonefish species in Hawaii (Friedlander et al. 2008). A recreational fishing guide on Oahu indicated that although netting of bonefish continues, it is not as prevalent as it once was (Adams pers. comm. 2011). It is therefore unclear whether the decline in landings is due to a change in effort or a true change in population size. Capture of recruits (CPUE) of Albula spp. in Kahana, Hawaii was highest in 1999 and has declined by 79% since that time (Friedlander et al. 2008).

This species is rare in Mauritius (Sato et al. 2008).

In Tarawa, there has been a dramatic increase in scale of effort and modernization of the fishing gears. In 1977, bonefish comprised 44.6% of the total catch; in 1992, they were 7.5% of the total catch. This decline (37.1% in 15 years) was a result of overfishing, as opposed to a change in fishing method and effort (Beets 2000). Spawning aggregations are often targeted (Beets 2000). A survey from the Fisheries Division of Kiribati conducted in 1995 shows that bonefish was the second-most common species caught, accounting for 7% of total catch. Gill nets caught 82% of the bonefish, with handlines providing the remainder (18%) of the catch (Friedlander et al. 2008). In Tarawa Lagoon, Kiribati, recent studies have demonstrated significant declines in abundance and average size of bonefish in the catch between 1977 and the late 1990s. The annual take of bonefish from Tarawa Lagoon is between 1,000,000 and 5,000,000 fish per year, but no stock assessment has been conducted (Friedlander et al. 2008). This species is probably the most abundant molluscivorous fish in the lagoon (Beets 2001). Comparison data from fished and protected locations at Palmyra Atoll show significant differences in population characteristics which may indicate that threats are expressed asymmetrically across its range (Adams pers. comm. 2011). Given fisheries characteristics throughout the region, we expect that in areas where bonefish are exposed to fishing effort that Tarawa serves as an example of what would likely occur in other areas throughout its range. In addition, the recreational fishery is not well-established in the Indo-Pacific, so there is little economic incentive for conservation. Therefore, we do not expect conservation to be occurring at present.

Like A. vulpes, A. glossodonta may be closely associated with mangroves and seagrasses and other shallow coastal habitats. Valiela et al. (2001) estimate that mangroves have decreased worldwide by 35%, at a rate of 2% per year. Using this estimate, mangroves have declined global by an estimated 27% over the last three generation lengths for A. glossodonta (13.5 years). Much of this species' distribution lies in the Indo-Pacific, where up to 14% of mangrove species are listed as threatened (Vulnerable, Endangered, or Critically Endangered) in some places (Polidoro et al. 2010). The Indo-Malay Philippine Archipelago is of particular concern, as it has one of the highest rates of mangrove loss globally, with an estimated 30% reduction in mangrove area since 1980 (FAO 2007). In the tropical Indo-Pacific, 12% of all seagrasses are currently threatened, and 20% of all seagrass species are experiencing declines. In the temperate North Pacific, the northern-most part of A. glossodonta's range, 22% of all seagrass species are threatened, and 44% are experiencing population declines (Short et al. 2011). Given the declines in these habitats, we infer that the extreme habitat loss in parts of its Pacific range will have similar negative consequences for population trajectories.

Given population declines of at least 30% over three generation lengths at Tarawa, significant habitat loss throughout much of its range, we estimate global decline to equal or exceed 30% over three generation lengths (13.5 years), with some substantially greater localized depletions in parts of the Indo-Pacific.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commercial landings of bonefish in Hawaii have decreased dramatically over the past few decades, presumably because of overfishing and loss of habitat, from over 300,000lbs in 1900 to less than 3,000lbs. since 2002. Bonefish were the most important species in the commercial seine fishery between 1966 and 1970, with average annual yields of nearly 18,000 pounds. Although the presence of multiple species within the fishery makes species-specific declines hard to pinpoint, the commercial seine catch now averages only 581lbs per year, accounting for less than 8% of the catch. Commercial landings of bonefish in Hawaii have declined from over 136.4 mt in 1900 to only 1.2 mt in 2001. This figure, however, includes all bonefish species in Hawaii (Friedlander et al. 2008).

Heavy fishing pressure and degradation of habitats at Tarawa and Kiritimati Atolls have resulted in the loss of pre-spawning staging sites and spawning migration routes, which may be responsible for the observed declines in bonefish catches, average size, and sex ratios at these locations (Friedlander et al. 2008). There are declines in CPUE, mean length and weight of fish and also a change in sex ratio (Beets 2000). Sex ratio (F:M) was 0.71:1 in 1977 and in 1992–1993 it was recorded as 0.15:1. In 1977, mean length was 46.4 cm and mean weight was 1.3 kg. In 1992, mean length recorded was 37.6 cm and mean weight was 0.84 kg. There was a decrease in the smallest size of sexually mature individuals between the two time periods: in 1977 the smallest size of sexually mature males was 42.5 cm and 46.5 cm for females; in 1992 is was 32 cm for males and 35 cm for females. In addition, Beets (2000) conservatively estimates that the 30% of total catch was non-reproductive. In Tarawa, there has been a dramatic increase in scale of effort and modernization of the fishing gears. In 1977, bonefish comprised 44.6% of the total catch; in 1992, they comprised only 7.5% of the total catch. Spawning aggregations are often targeted (Beets 2000). The effects of catch-and-release fishing on this species are unclear.

Unrestrained growth of human populations in the coastal zones has also accelerated habitat destruction, water quality degradation, and disruption of prey species dynamics. Fishing and habitat loss and degradation may pose the most significant threats to this species. Disruptions to shallow coastal ecosystems such as seagrasses and mangroves due to climate change may pose significant future threats to this species, particularly in areas with accelerated rates of coastal development and urbanization.

The limited range of this species may also make it vulnerable to local threats, such as habitat loss (Friedlander et al. 2008). It has been noted that habitat alteration, fragmentation and loss may contribute to the decline in abundance of this species in Tarawa (Beets 2000). Bonefish are closely associated with mangroves,seagrasses and other shallow coastal habitats. Given the dramatic declines in these habitats (Mumby et al. 2004, Valiela et al. 2001, Polidoro et al. 2010, Orth et al. 2006, Short et al. 2011), we infer that comparable regional declines are likely throughout its range. Valiela et al. (2001) estimates that mangroves have decreased worldwide by 35%, at a rate of 2% per year. Since bonefish rely upon habitats of limited extent, they are especially susceptible to habitat loss and degradation, particularly due to climatic and anthropogenic influences. These habitats are often fragmented in nature, exacerbating this issue. As with other coastal species, fragmentation will likely have direct and indirect negative impacts on bonefish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bcd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
State regulations in Hawaii recently raised the minimum size regulation from 23 cm (9 in.) total length (TL) to 36 cm (14 in.) TL, although there is neither a closed season nor bag limit (Friedlander et al. 2008). Albula glossodonta likely occurs in Marine Protected Areas (MPAs) in parts of its range. In addition, the recreational fishery is not well-established in the much of the Indo-Pacific, so there is little economic incentive for conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; bait: usually; price category: unknown; price reliability:
  • Shaklee, J.B. 1984 Albulidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 1. [pag. var.]. FAO, Rome. (Ref. 3289)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Shortjaw bonefish

Albula glossodonta (roundjaw bonefish, shortjaw bonefish, Indo-Pacific bonefish, sharpjaw bonefish, or smallmouth bonefish)[1] is a type of marine fish found in the Pacific Ocean. They grow up to 70 cm.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2014). "Albula glossodonta" in FishBase. May 2014 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!