Skip to content

Albula glossodonta — Details

Indo-pacific Bonefish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits mud flats of turbid inner reefs and mangroves and sandy lagoons (Ref. 9710). Benthopelagic in shallow, coastal areas (Ref. 58302). Grabs food from the substratum using its snout. Can tolerate oxygen poor water by inhaling air into a lung-like air bladder (Ref. 9710). Migrates to mass spawn at seaward mouths of channels on lunar cycle (Ref. 9710). Sold fresh in markets but seldom used for human consumption.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Distribution

Learn more about this article

Aldabra, Chagos, Comores, Madagascar, Mauritius, Red Sea, Reunion, Seychelles, Somalia

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Indo-Pacific: Red Sea to the Hawaiian and Tuamoto Islands, north to southern Japan, south to Lord Howe Island, Australia; throughout Micronesia.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 0; Dorsal soft rays (total): 15 - 19; Analspines: 0; Analsoft rays: 8 - 9

Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. http://www.fishbase.org/references/FBRefSummary.php?id=4538

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 900 mm SL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

90.0 cm SL (male/unsexed; (Ref. 1602)); max. published weight: 8,610 g (Ref. 5450)

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Bouhlel, M. 1988 Poissons de Djibouti. Placerville (California, USA): RDA International, Inc. 416 p. (Ref. 5450) http://www.fishbase.org/references/FBRefSummary.php?id=5450&speccode=11512

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Diagnostic Description

Description

Learn more about this article

Look up in FishBase

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Tip of lower jaw broadly rounded; a spot of black pigment often present on the underside of snout, at least in smaller individuals; tooth patches on parasphenoid and basibranchial bones more broadly oval in shape, average width/length 0.38 and 0.45, respectively; number of teeth in pharyngobranchial tooth patch usually 5-15 (Ref. 9828). Compared to A. argentea which has a yellow spot on the axil of the pectoral fin, in this species, there is none (Ref. 74924).

Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. http://www.fishbase.org/references/FBRefSummary.php?id=4538

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; oceanodromous (Ref. 51243); brackish; marine

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Migration

Learn more about this article

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Albula glossodonta

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC0393-06|AP002973|Albula glossodonta| ACTCGATGGTTCTTTTCCACTAACCACAAAGATATCGGTACCCTCTATTTAGTGTTCGGCGCTTGGGCCGGAATGGTGGGTACAGCTTTG---AGTCTCCTAATCCGGGCGGAGCTAAGTCAGCCCGGGGCTTTGTTGGGGGAT---GATCAAATTTACAATGTTATTGTTACAGCGCATGCTTTTGTAATGATTTTCTTTATAGTGATGCCGATCTTGATCGGTGGGTTTGGTAACTGGCTTGTCCCACTTATG---ATTGGGGCGCCGGATATGGCGTTTCCTCGTATGAATAATATGAGTTTCTGATTGCTACCCCCCTCGTTCCTGCTTCTTCTAGCTTCTTCTGGGGTTGAAGCGGGGGCTGGGACGGGGTGGACGGTTTATCCTCCTCTTTCTGGGAATTTGGCTCATGCTGGGGCGTCGGTAGACTTG---ACTATCTTCTCTCTACATCTTGCAGGTGTCTCTTCAATCCTTGGGGCTATCAATTTTATTACTACAATTATTAATATGAAGCCTCCTGCTATTTCCCAGTATCAGACTCCTTTATTTGTTTGGTCTGTCCTGGTGACCGCAGTTCTCTTGCTGTTGTCTTTGCCTGTCCTGGCTGCA---GGTATTACTATGCTTCTGACTGACCGTAATCTCAACACCACTTTCTTTGACCCGGCGGGAGGAGGGGATCCTATTTTATATCAGCACTTGTTTTGGTTCTTCGGTCATCCTGAGGTTTATATTCTTATTCTCCCAGGGTTTGGTATGATCTCACACATTGTTGCTTACTATTCTGGCAAGAAG---GAGCCTTTCGGTTATATGGGGATGGTTTGGGCTATGATGGCCATTGGCCTTCTTGGTTTCATTGTTTGGGCCCATCATATGTTTACTGTTGGGATGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Albula glossodonta

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: minor commercial; gamefish: yes; bait: usually

Shaklee, J.B. 1984 Albulidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 1. [pag. var.]. FAO, Rome. (Ref. 3289) http://www.fishbase.org/references/FBRefSummary.php?id=3289&speccode=11512

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Shortjaw Bonefish

Learn more about this article

The Shortjaw Bonefish is a type of marine fish that lives in the Pacific Ocean. They grow up to 70 cm.

This Perciformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!