Overview

Distribution

Azores, Azores Exclusive Economic Zone, Black Sea, East Atlantic, East Mediterranean, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, Greek Exclusive Economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Madeira, Mediterranean Sea, Ukrainian Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eriphia verrucosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATATTTTATTTTTGGAGCTTGAGCTGGCATAGTAGGAACTTCATTAAGACTTATTATTCGAGCTGAATTAGGTCAACCAGGTACCCTAATTGGTAACGATCAAATTTATAATGTTGTAGTAACTGCCCATGCTTTTGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTTGTTCCTTTAATATTAGGTGCTCCTGACATAGCCTTCCCACGTATAAACAACATAAGATTTTGACTTTTACCCCCATCTCTTACTCTTCTCCTAATAAGAGGTATAGTAGAAAGAGGAGTCGGAACTGGCTGAACAGTCTATCCTCCACTTGCTGCTGCAATTGCTCACGCTGGGGCATCAGTCGATATGGGAATTTTTTCTCTCCACCTAGCAGGTGTCTCCTCCATTCTAGGGGCAGTTAACTTTATAACTACTGTTATTAATATACGATCATTTGGTATAACAATAGACCAAATACCTTTATTTGTATGGGCCGTTTTTATTACAGCAATTTTACTTTTATTGTCACTTCCCGTTTTAGCAGGTGCTATTACTATACTCTTAACTGACCGTAACCTAAATACTTCCTTCTTCGATCCTGCTGGAGGAGGTGATCCCGTCTTATACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eriphia verrucosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eriphia verrucosa

Eriphia verrucosa, sometimes called the warty crab[3] or yellow crab,[4] is a species of crab found in the Black Sea, Mediterranean Sea and eastern Atlantic Ocean from Brittany to Mauritania and the Azores.[3] Individual crabs have been caught as far north as Cornwall.[5] Formerly a frequent species in the Black Sea, it has decreased in numbers since the 1980s and is now listed in the Ukrainian Red Data Book of endangered species.[2]

Contents

Ecology [edit]

E. verrucosa lives among stones and seaweeds in shallow water along rocky coastlines up to a depth of 15 metres (49 ft).[3] It is reported to feed on bivalves, gastropods and hermit crabs,[6] or on molluscs and polychaetes.[3] In the Black Sea, E. verrucosa is the only native species capable of breaking into the shells of the invasive snail Rapana venosa, although it is unlikely that it will present an effective biological control of the invader.[7] The species is threatened by eutrophication and pollution.[2]

Description [edit]

E. verrucosa may reach a width of 9 centimetres (3.5 in) and a length of 7 cm (2.8 in).[3] The carapace is thick and smooth, ranging in colour from brownish-red to brownish-green, with yellow spots; its front margin is armed with seven "teeth" on either side, and five or six between the eyes. The claws are strong and have black fingers; one claw is generally larger than the other and is armed with rounded tubercles while the smaller claw bears sharper projections, arranged in lines. In the springtime, E. verrucosa migrates to shallow water, less than 1 metre (3 ft 3 in) deep, and reproduction begins in May or June; the species is highly fecund. There are four larval stages, from zoea to megalopa.[2]

References [edit]

  1. ^ "Eriphia verrucosa (Forskal, 1775)". Integrated Taxonomic Information System. Retrieved October 7, 2010. 
  2. ^ a b c d C. Dumitrache & T. Konsulova. "Eriphia verrucosa Forskall, 1755". Black Sea Red Data Book. United Nations Environment Programme. Retrieved January 27, 2009. 
  3. ^ a b c d e "Eriphia verrucosa". European Virtual Aquarium. Retrieved January 27, 2009. 
  4. ^ "Fishes & other marine life". Caradon Field & Natural History Club. Retrieved January 27, 2009. 
  5. ^ "Verified sightings for Eriphia verrucosa". Marine Life Information Network. Retrieved January 27, 2009. 
  6. ^ A. C. Rossi & V. Parisi (1973). "Experimental studies of predation by the crab Eriphia verrucosa on both snail and hermit crabs occupants of conspecific gastropod shells". Bollettino di Zoologia 40: 117–135. 
  7. ^ Dragos Micu & Valentina Todorova. "Biodiversity of the Western Black Sea". MarBEF Newsletter (Autumn 2007): 26–28. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!