Molecular Biology and Genetics
Molecular Biology
Barcode data: Hydriomena Janzen07
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 37 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 37 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNAACTTTATATTTTATCTTTGGAATCTGAGCAGGTATGGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCCTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATGCTTGGAGCCCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTACTCCCCCCATCATTAACCTTGTTAATTTCTAGAAGTATCGTAGAAAATGGAGCAGGAACTGGTTGAACCGTTTACCCCCCCTTATCTTCTAACATTGCTCATGGAGGAAGCTCTGTAGATTTAGCTATTTTTTCTCTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATCACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTCTGAGCTGTAGGAATTACAGCATTTCTTTTATTATTATCTTTACCCGTTTTAGCAGGAGCTATTACAATACTTTTAACAGATCGAAATTTAAATACATCATTTTTTGACCCCGCAGGAGGAGGAGATCCTATCCTTTATCAACATTTATTTNN
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena Janzen07
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 34
Species With Barcodes: 1
Public Records: 16
Specimens with Barcodes: 34
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena cf. furcata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 19
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 19
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena AH01Pe
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep384
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena AM01Br
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena AH01Ec
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep458
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep382
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep225
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 16
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 16
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep224
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena BioLep142
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Hydriomena Janzen21
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAACTTCCTTAAGTTTATTAATTCGAGCAGAATTAGGAACTCCTGGCTCTTTAATTGGAGATGATCAAATTTATAACACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGTGGATTTGGAAATTGATTAGTCCCCCTAATACTAGGGGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCCCCATCTATTACTCTTCTAATTTCCAGAAGAATTGTTGAAAATGGAGCTGGGACTGGTTGAACAGTTTACCCCCCTTTATCCTCTAATATTGCCCATGGAGGAAGCTCTGTAGATTTAGCTATTTTTTCCTTACATTTGGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGTTTAAATAATATATTTTTTGATCAATTACCCCTATTTGTTTGAGCCGTAGGAATCACAGCATTTTTACTTTTACTATCTTTACCAGTTTTAGCGGGAGCTATTACCATACTTTTAACCGATCGAAACTTAAATACTTCATTTTTTGACCCCGCAGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena Janzen21
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hydriomena Janzen209
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 1,720 | Public Records: | 505 |
| Specimens with Sequences: | 1,677 | Public Species: | 38 |
| Specimens with Barcodes: | 1,611 | Public BINs: | 37 |
| Species: | 79 | ||
| Species With Barcodes: | 75 | ||
© Barcode of Life Data Systems
Trusted
Barcode data
© Barcode of Life Data Systems
Trusted
Locations of barcode samples
Collection Sites: world map showing specimen collection locations for Hydriomena
© Barcode of Life Data Systems
Trusted
Wikipedia
Hydriomena
Hydriomena is a genus of moth in the family Geometridae.
Species
- Hydriomena albifasciata (Packard, 1874)
- Hydriomena albimontanata McDunnough, 1939
- Hydriomena arizonata Barnes & McDunnough, 1917
- Hydriomena barnesata Swett, 1909
- Hydriomena bistriolata (Zeller, 1872)
- Hydriomena borussata Barnes & McDunnough, 1918
- Hydriomena bryanti McDunnough, 1943
- Hydriomena californiata Packard, 1871
- Hydriomena catalinata McDunnough, 1943
- Hydriomena charlestonia McDunnough, 1954
- Hydriomena chiricahuata Swett, 1909
- Hydriomena clarki W.S. Wright, 1920
- Hydriomena cochiseata Swett, 1909
- Hydriomena costipunctata Barnes & McDunnough, 1912
- Hydriomena crokeri Swett, 1910
- Hydriomena cyriadoides McDunnough, 1954
- Hydriomena divisaria (Walker, 1860)
- Hydriomena edenata Swett, 1909
- Hydriomena exculpata Barnes & McDunnough, 1917
- Hydriomena expurgata Barnes & McDunnough, 1918
- Hydriomena feminata McDunnough, 1944
- Hydriomena furcata – July Highflyer (Thunberg, 1784)
- Hydriomena furculoides Barnes & McDunnough, 1917
- Hydriomena furtivata McDunnough, 1939
- Hydriomena glaucata (Packard, 1874)
- Hydriomena gracillima McDunnough, 1944
- Hydriomena henshawi Swett, 1912
- Hydriomena impluviata – May Highflyer (Denis & Schiffermüller, 1775)
- Hydriomena irata Swett, 1910
- Hydriomena johstoni McDunnough, 1954
- Hydriomena macdunnoughi Swett, 1918
- Hydriomena magnificata Taylor, 1906
- Hydriomena manzanita Taylor, 1906
- Hydriomena marinata Barnes & McDunnough, 1917
- Hydriomena mississippiensis McDunnough, 1952
- Hydriomena modestata Barnes & McDunnough, 1917
- Hydriomena morosata Barnes & McDunnough, 1917
- Hydriomena muscata Barnes & McDunnough, 1917
- Hydriomena nevadae Barnes & McDunnough, 1917
- Hydriomena nubilofasciata (Packard, 1871)
- Hydriomena obliquilinea Barnes & McDunnough, 1917
- Hydriomena peratica Rindge, 1956
- Hydriomena perfracta Swett, 1910
- Hydriomena pluviata (Guenée, 1857)
- Hydriomena quinquefasciata (Packard, 1871)
- Hydriomena regulata Pearsall, 1909
- Hydriomena renunciata (Walker, 1862)
- Hydriomena rita McDunnough, 1954
- Hydriomena ruberata – Ruddy Highflyer (Freyer, 1831)
- Hydriomena septemberata McDunnough, 1952
- Hydriomena shasta Barnes & McDunnough, 1917
- Hydriomena sierrae Barnes & McDunnough, 1917
- Hydriomena similaris Hulst, 1896
- Hydriomena speciosata (Packard, 1874)
- Hydriomena sperryi McDunnough, 1952
- Hydriomena transfigurata Swett, 1912
- Hydriomena tuolumne Barnes & McDunnough, 1917
The extinct species Hydriomena? protrita Cockerell, 1922 from the Priabonian age Florissant Formation is possibly a member of the genus.[1]
References
- ^ Cockerell, T. D. A. (1922). "A fossil Moth from Florissant, Colorado". American Museum Novitates 34: 1–2. http://books.google.com/books?hl=en&lr=&id=sZNPAAAAYAAJ&oi=fnd&pg=PR3&dq=Hydriomena%22+protrita&ots=-RrpFq6jym&sig=0Oeb3wKhix4bfLCnM2psJf89QQc#v=onepage&q=Hydriomena%22%20protrita&f=false.
References
 | This Larentiinae moth related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
