Macrobrachium rosenbergii — Details

Giant Freshwater Prawn, Giant River Prawn, (german: Rosenberggarnele) learn more about names for this taxon

Overview

Distribution

Distribution

Bangladesh, FAO fishing area 34, FAO fishing area 47, French Polynesian Exclusive Economic Zone, Germany, Gulf of Mexico, Iceland, India, Indonesia, Japan, Malaysia, New Zealand Exclusive Economic Zone, Thailand, United States
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1.5

Graphical representation

Depth range (m): 1 - 1.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrobrachium rosenbergii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCMD0417-06|AY659990|Macrobrachium rosenbergii| CAACGGTGGCTTTTCTCAACAAACCATAAAGACATTGGAACACTATATTTTATCTTCGGAGCGTGAGCAGGCATGGTAGGTACGTCACTA---AGACTCTTAATTCGAGCAGAATTAGGGCAGCCGGGCAGACTGATCGGAAAT---GACCAAATCTACAACGTAATTGTCACTGCCCACGCATTCGTAATAATTTTTTTCATGGTTATACCGATCATAATTGGTGGTTTCGGTAATTGACTAGTACCCCTAATATCA---GGGGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGATTCTGACTCCTACCCCCATCTCTAACACTTCTTCTCTCCAGAGGAATAGTAGAAAGAGGGGTTGGCACAGGATGAACTGTTTATCCACCACTAGCGGCCGGTACCGCCCACGCCGGGGCATCGGTAGATCTAGGT---ATTTTTTCCCTCCACCTAGCAGGAGTTTCTTCAATCTTAGGGGCTGTCAACTTTATTACCACAGTGATTAACATACGAGCCCCAGGAATAACTATAGATCGACTGCCCCTATTCGTATGAGCCGTATTTCTAACAGCCATCCTGCTTCTTCTCTCACTACCAGTTTTAGCCGGA---GCCATTACCATACTCTTAACTGATCGAAACCTAAATACATCCTTTTTCGACCCAGCGGGAGGAGGGGACCCTATTCTCTACCAACACTTATTTTGATTCTTTGGGCACCCAGAAGTATACATTTTAACCCTACCGGCCTTCGGTATAATCTCTCACATTGTAAGACAAGAGTCAGGGAAAAAA---GAATCATTTGGAACCCTAGGAATAGTATACGCCATAATAGCAATTGGAGTTCTCGGATTCGTTGTCTGAGCGCACCACATGTTCACCGTTGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macrobrachium rosenbergii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Macrobrachium rosenbergii

Macrobrachium rosenbergii, also known as the giant river prawn, giant freshwater prawn, Malaysian prawn, freshwater scampi (especially in India), or cherabin, is a species of freshwater shrimp (not a prawn or scampo in terms of phylogeny, although colloquially "prawn" can refer to freshwater shrimp or true prawns) native to the Indo-Pacific region, northern Australia and Southeast Asia. This species (as well as other Macrobrachium) is commercially important for its value as a food source.[1]

While M. rosenbergii is considered a freshwater species, the larval stage of the animal depends on brackish water.[2] Once the individual shrimp has grown beyond the planktonic stage and become a juvenile, it will live entirely in freshwater.[2]

Contents

Description

Grilled giant river prawns in Thai cuisine; each (whole) prawn weighing around 500 grams

M. rosenbergii can grow to a length of over 30 centimetres (12 in).[1]

Morphotypes

There are three different morphotypes of males.[3] The first stage is called "small male" (SM); this smallest stage has short, nearly translucent claws. If conditions allow, small males grow and metamorphose into "orange claws" (OC), which have large orange claws on their second chelipeds, which may have a length of 0.8 to 1.4 their body size.[3] OC males later may transform into the third and final stage, the "blue claw" (BC) males. These have blue claws, and their second chelipeds may become twice as long as their body.[2][3]

Male M. rosenbergii have a strict hierarchy: the territorial BC males dominate the OCs, which in turn dominate the SMs.[3] The presence of BC males inhibts the growth of SMs and delays the metamorphosis of OCs into BCs; an OC will keep growing until it is larger than the largest BC male in its neighbourhood before transforming.[3] All three male stages are sexually active, and females who have undergone their pre-mating moult will co-operate with any male to reproduce. BC males protect the female until their shell has hardened; OCs and SMs show no such behaviour.[3]

Life cycle

In mating, the male deposits spermatophores on the underside of the female's thorax, between the walking legs. The female then extrudes eggs, which pass through the spermatophores. The female carries the fertilised eggs with her until they hatch; the time may vary, but is generally less than three weeks. Females lay 10,000–50,000 eggs up to five times per year.[2]

From these eggs hatch zoeae, the first larval stage of crustaceans. They go through several larval stages before metamorphosing into postlarvae, at which stage they are 0.28–0.39 inch (7.1–9.9 mm) long and resemble adults.[2] This metamorphosis usually takes place about 32 to 35 days after hatching.[2] These postlarvae then migrate back into freshwater.

See also

References

  1. ^ a b T. Y. Chan (1998). "Shrimps and Prawns". In Kent E. Carpenter & Volker H. Niem. The Living Marine Resources of the Western Central Pacific. Volume 2: Cephalopods, Crustaceans, Holothurians and Sharks. FAO Species Identification Guide for Fishery Purposes. Food and Agriculture Organization. ISBN 92-5-104051-6. http://smdec.com/keyfao/SHRIMPS%20AND%20PRAWNS/data/60404.pdf. 
  2. ^ a b c d e f Forrest Wynne (May 2000). "Grow-out culture of freshwater prawns in Kentucky". Archived from the original on August 21, 2008. http://replay.web.archive.org/20080821114126/http://www.aquanic.org/publicat/state/ky/prawn_ext.htm. Retrieved July 4, 2005. 
  3. ^ a b c d e f A. Barki, I. Karplus & M. Goren (1991). "Morphotype related dominance hierarchies in males of Macrobrachium rosenbergii (Crustacea, Palaemonidae)". Behaviour 117 (3/4): 145–160. JSTOR 4534936. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!