Macrobrachium rosenbergii — Details

Giant Freshwater Prawn, Giant River Prawn, (german: Rosenberggarnele) learn more about names for this taxon

Overview

Distribution

Range Description

The natural range of this species is eastwards from eastern Pakistan up to Borneo and Java (Wowor and Ng 2007, as M.dacqueti). The species is widely cultured both within its natural range and far beyond (Africa, South America). Established populations of aquaculture escapees have been recorded in Para, Brazil (Silva-Oliviera et al. 2011) and Martinique (Lim et al. 2002). Further specimens have been in Sao Paulo state, but these may represent a non-breeding population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species lives in large rivers and stream with a connection to the sea.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1.5

Graphical representation

Depth range (m): 1 - 1.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrobrachium rosenbergii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGGTGGCTTTTCTCAACAAACCATAAAGACATTGGAACACTATATTTTATCTTCGGAGCGTGAGCAGGCATGGTAGGTACGTCACTAAGACTCTTAATTCGAGCAGAATTAGGGCAGCCGGGCAGACTGATCGGAAATGACCAAATCTACAACGTAATTGTCACTGCCCACGCATTCGTAATAATTTTTTTCATGGTTATACCGATCATAATTGGTGGTTTCGGTAATTGACTAGTACCCCTAATATCAGGGGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGATTCTGACTCCTACCCCCATCTCTAACACTTCTTCTCTCCAGAGGAATAGTAGAAAGAGGGGTTGGCACAGGATGAACTGTTTATCCACCACTAGCGGCCGGTACCGCCCACGCCGGGGCATCGGTAGATCTAGGTATTTTTTCCCTCCACCTAGCAGGAGTTTCTTCAATCTTAGGGGCTGTCAACTTTATTACCACAGTGATTAACATACGAGCCCCAGGAATAACTATAGATCGACTGCCCCTATTCGTATGAGCCGTATTTCTAACAGCCATCCTGCTTCTTCTCTCACTACCAGTTTTAGCCGGAGCCATTACCATACTCTTAACTGATCGAAACCTAAATACATCCTTTTTCGACCCAGCGGGAGGAGGGGACCCTATTCTCTACCAACACTTATTTTGATTCTTTGGGCACCCAGAAGTATACATTTTAACCCTACCGGCCTTCGGTATAATCTCTCACATTGTAAGACAAGAGTCAGGGAAAAAAGAATCATTTGGAACCCTAGGAATAGTATACGCCATAATAGCAATTGGAGTTCTCGGATTCGTTGTCTGAGCGCACCACATGTTCACCGTTGGGATAGACGTAGACACACGAGCCTATTTCACCTCCGCCACAATGATTATTGCCGTGCCGACAGGAATCAAAATTTTCAGATGATTGGCCACCCTTCATGGCACACAATTCACCTACAGACCCTCCTTAATCTGAGCCCTAGGATTTATTTTCCTATTCACCATAGGAGGACTAACAGGAGTAGTCCTCGCTAACTCATCTATTGACATCATCCTCCATGACACATACTACGTAGTTGCTCACTTTCACTACGTTCTATCCATAGGAGCCGTATTCGGCATCTTCGCAGGAATCGCTCACTGATTCCCCCTATTCACAGGCATATCTCTTCACCCCAAATGACTAAAAATCCACTTCACAACAATGTTCATTGGAGTCAATCTCATCGTCTTTCCTCAACACTTCCTAGGACTAAATGGTATACCCCGACGATATTCAGACTACCCAGATGCCTACACAACGTGAAACGTCGTATCTTCAATTGGATCATCAATCTCCCTAATCGCAGTGTTAGGATTTATCATAGTAGTATGAGAGGCATTAACATCTAAACGACCCGCCCTATTCTCTTGATTCATACCAACTTCTATCGAGTGACAACACAACTTCCCACCAGCAGATCACAGATACATAGAAATCCCCCTAACAGCTAACTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Macrobrachium rosenbergii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
De Grave, S., Shy, J., Wowor, D. & Page, T.

Reviewer/s
Cumberlidge, N. & Smith, K.

Contributor/s

Justification
The natural range of this species is eastwards from eastern Pakistan up to Borneo and Java (Wowor and Ng 2007, as M.dacqueti). Throughout its range it is extensively fished for, as well as being the main focus for freshwater shrimp aquaculture. Although commercially fished for throughout its range it is not thought to represent a threat to the global population. In view of its large natural range and the absence of any known, major threats the species is considered as of Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Despite being intensely studied for aquaculture purposes, the population trends in wild populations are unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No threats have been identified to the species. Although it is commercially fished for throughout its range, this is not thought to represent a threat to the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific conservation actions are in place, although in many parts of its range it likely occurs in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Macrobrachium rosenbergii

Macrobrachium rosenbergii, also known as the giant river prawn, giant freshwater prawn, Malaysian prawn, freshwater scampi (especially in India: in West Bengal it is called Golda Chingdi), or cherabin, is a species of freshwater shrimp native to the Indo-Pacific region, northern Australia and Southeast Asia. This species (as well as other Macrobrachium) is commercially important for its value as a food source.[2]

While M. rosenbergii is considered a freshwater species, the larval stage of the animal depends on brackish water.[3] Once the individual shrimp has grown beyond the planktonic stage and become a juvenile, it will live entirely in freshwater.[3]

Description[edit]

Grilled giant river prawns in Thai cuisine; each (whole) prawn weighing around 500 grams

M. rosenbergii can grow to a length of over 30 centimetres (12 in).[2]

Morphotypes[edit]

There are three different morphotypes of males.[4] The first stage is called "small male" (SM); this smallest stage has short, nearly translucent claws. If conditions allow, small males grow and metamorphose into "orange claws" (OC), which have large orange claws on their second chelipeds, which may have a length of 0.8 to 1.4 their body size.[4] OC males later may transform into the third and final stage, the "blue claw" (BC) males. These have blue claws, and their second chelipeds may become twice as long as their body.[3][4]

Male M. rosenbergii have a strict hierarchy: the territorial BC males dominate the OCs, which in turn dominate the SMs.[4] The presence of BC males inhibts the growth of SMs and delays the metamorphosis of OCs into BCs; an OC will keep growing until it is larger than the largest BC male in its neighbourhood before transforming.[4] All three male stages are sexually active, and females who have undergone their pre-mating moult will co-operate with any male to reproduce. BC males protect the female until their shell has hardened; OCs and SMs show no such behaviour.[4]

Life cycle[edit]

In mating, the male deposits spermatophores on the underside of the female's thorax, between the walking legs. The female then extrudes eggs, which pass through the spermatophores. The female carries the fertilised eggs with her until they hatch; the time may vary, but is generally less than three weeks. Females lay 10,000–50,000 eggs up to five times per year.[3]

From these eggs hatch zoeae, the first larval stage of crustaceans. They go through several larval stages before metamorphosing into postlarvae, at which stage they are 0.28–0.39 inches (7.1–9.9 mm) long and resemble adults.[3] This metamorphosis usually takes place about 32 to 35 days after hatching.[3] These postlarvae then migrate back into freshwater.

See also[edit]

References[edit]

  1. ^ S. De Grave, J. Shy, D. Wowor & T. Page (2013). "Macrobrachium rosenbergii". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 13 July 2013. 
  2. ^ a b T. Y. Chan (1998). "Shrimps and Prawns". In Kent E. Carpenter & Volker H. Niem. The Living Marine Resources of the Western Central Pacific. Volume 2: Cephalopods, Crustaceans, Holothurians and Sharks. FAO Species Identification Guide for Fishery Purposes. Food and Agriculture Organization. ISBN 92-5-104051-6. 
  3. ^ a b c d e f Forrest Wynne (May 2000). "Grow-out culture of freshwater prawns in Kentucky". Archived from the original on August 21, 2008. Retrieved July 4, 2005. 
  4. ^ a b c d e f A. Barki, I. Karplus & M. Goren (1991). "Morphotype related dominance hierarchies in males of Macrobrachium rosenbergii (Crustacea, Palaemonidae)". Behaviour 117 (3/4): 145–160. doi:10.1163/156853991x00508. JSTOR 4534936. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!