Overview

Brief Summary

Biology

Oribi are commonly found in pairs or in groups of as many as seven (2). Such groups usually have a single adult male (2), and up to three adult females (3). These groups are territorial (2), and will mark the boundaries of their territory with urine, faeces and secretions from the preorbital glands on their faces (2). Active during the day, oribi graze on fresh grass during the wet season, and browse on shrubs when drought occurs. To supplement their diet, oribi visits mineral licks every few days (4). Although oribi may give birth throughout the year, birthing is said to be most common in the rainy months (4), when there is plentiful food and cover (2). After a gestation period of 200 to 210 days, a single young is born (2). Male oribi become sexually mature by 14 months, while females can conceive at the age of just 10 months (4). If threatened by a predator, the oribi will remain hiding in tall grass until the predator is within a few metres. It will then leap through the grass and bound along, flashing the conspicuous white underside of its tail which serves as a warning to other oribi (2). Oribi will also produce a shrill whistle when alarmed and are seen to jump vertically up with all four legs straight and the back arched when they are under threat, known as stotting (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The smallest true grazer amongst the antelope (3), the oribi is a medium-sized ungulate with slender legs, a long neck, and small pointed horns. The silky coat of the oribi is yellow to reddish-brown on the back but is white on the belly. Each knee has a long tuft of hair, and the tail is short and black with a white underside. The eyes have a white line of fur above them, often used to help distinguish them from other ungulate species. Beneath the ears are dark, hairless patches, and on the sides of the face are vertical creases that house the preorbital glands. These glands produce an odorous secretion that is used to mark the oribi's territory (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The distribution of Ourebia ourebi is patchy and discontinuous throughout the grasslands of central and southern Africa. It is found in the moist areas of Northern and Southern savanna, across Guinea Savanna to Ethiopia and south through western East Africa to Tanzania (Estes, 1991).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

The Oribi has a patchy distribution ranging from Senegal to Ethiopia and Eritrea and south through eastern Africa to Angola and the Eastern Cape of South Africa (East 1999; Brashares and Arcese in press). It still occurs widely within its former distribution but its populations are becoming increasingly fragmented as it is gradually eliminated from moderately to densely settled areas. They are now probably extinct in Burundi (East 1999).

Haggard’s Oribi is entirely isolated from other forms in coastal Kenya to southern Somalia (Hillman et al. 1998; East 1999).

The Kenya Oribi formerly occurred on the lower slopes of Mount Kenya but is now extinct (Hillman et al. 1998; East 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The oribi occurs in the savannah grasslands of Africa south of the Sahara. Haggard's oribi is found in Kenya and Somalia, and the Kenya oribi was found only in Kenya (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The oribi has silky, yellow to reddish-brown coat with white fur on underparts of body and rump. Also, it has a distinctive white line of fur over its eye and a bare, dark patch beneath each ear. Ourebia ourebi also has a tuft of long hair on each "knee" and a short black tail (Encyclopedia Britannica, 2004). It has very distinct preorbital glands that fill most of the space between the eye and mouth. These glands appear as vertical folds on the side of the face. The oribi stands about 50-66cm to the shoulder and has a body length ranging from 92-110cm. It has very long legs and neck. Males have small, spike like horns that range from 8-19cm in length (Smith, 1985).

Range mass: 12 to 22 kg.

Range length: 92 to 110 cm.

Sexual Dimorphism: ornamentation

Other Physical Features: endothermic ; bilateral symmetry

  • Encyclopedia Britannica, 2004. "Oribi" (On-line). Encyclopedia Britannica Online. Accessed 11/01/04 at http://search.eb.com/eb/article?tocId=9057366.
  • Smith, Stephen J., 1985. The Atlas of Africa's Principal Mammals. Republic of South Africa: Natural History Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Ourebia ourebi live in open grasslands. They prefer short grasses with patchy areas of tall grasses to provide hiding places. They like grasslands that are not extremely tall or dense and with some bushes. They avoid steep slopes.

Terrestrial Biomes: savanna or grassland ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Oribi inhabit savanna woodlands, floodplains and other open grasslands, from around sea level to about 2,000 m asl. They reach their highest density on floodplains and moist tropical grasslands, especially in association with large grazers.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits open grasslands, preferring habitats with short grasses on which to graze, interspersed with tall grasses for hiding in (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The oribi is both a grazer and browser. It grazes during the wet season when fresh grass is readily available, and it browses when drought occurs and fresh grass is less common. This herbivorous mammal consumes at least eleven different herbs and eats the foliage from seven different trees. It has also been known to visit mineral licks every one to three days (Kingdon, 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Natural enemies of the oribi include leopards, caracals and pythons. Young oribi also are threatened by jackals, the Libyan wildcat, ratels, baboons, eagles and monitors.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Typical lifespan

Status: wild:
8 to 12 years.

Average lifespan

Status: captivity:
14.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ourebia ourebi breeds throughout the year, with its peak season in October and November (Openshaw, 1993). The oribi has a monogomous to polygynous mating system with the males maintaining the territory and sharing it with one to two or more females. Females are able to conceive as early as ten months and males are sexually active by fourteen months (Estes, 1991). Their gestation period lasts from six to seven months and one young is borne at a time.

Breeding interval: Breed once per year.

Breeding season: Can breed year-round, peak in October-November.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 6 to 7 months.

Range weaning age: 4 to 5 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 14 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 2235 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
426 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

Parental Investment: altricial

  • Estes, R. 1991. The Behavior Guide to African Mammals. Los Angeles, California: University of California Press.
  • Openshaw, P. 1993. Mass capture of antelope, buffalo, giraffe, and zebra. A McKenzie, ed. The Capture and Care Manual: Capture, Care, Accommodation, and Transportation of Wild African Animals. Wildlife Decision Support Services. Accessed November 01, 2004 at http://wildnetafrica.co.za/estate/capturecare/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ourebia ourebi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACTAACCACAAAGACATCGGCACCTTATACCTTCTATTCGGAGCCTGAGCCGGTATAGTAGGTACCGCCCTAAGCCTGTTAATTCGCGCTGAATTGGGTCAACCCGGAACCCTGCTTGGAGATGACCAAATCTACAACGTAGTTGTAACCGCACATGCATTCGTAATAATCTTCTTTATAGTAATACCCATTATAATCGGAGGGTTTGGCAACTGACTAGTTCCCTTAATAATTGGAGCCCCTGACATAGCATTTCCCCGAATAAACAACATAAGTTTTTGACTTCTACCTCCCTCCTTCCTACTACTTCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGGACAGGCTGAACCGTATATCCCCCTCTAGCAGGTAACCTAGCACATGCAGGGGCTTCAGTAGACCTAACTATTTTTTCCCTACACCTGGCAGGTGTTTCTTCAATCCTGGGGGCTATCAATTTCATCACAACAATTATTAACATGAAACCCCCTGCAATATCCCAGTATCAAACCCCTCTATTCGTGTGATCCGTCCTAATTACTGCTGTACTACTACTTCTCTCACTCCCAGTATTAGCCGCTGGTATTACAATACTCCTAACAGACCGAAACCTAAACACAACCTTTTTCGACCCAGCAGGAGGAGGGGACCCAATCCTATATCAACACCTATTTTGATTCTTCGGACACCCCGAAGTATATATTCTTATTTTACCCGGATTTGGAATAATCTCCCATATTGTCACCTACTACTCAGGGAAAAAAGAACCATTTGGATATATGGGAATAGTATGAGCCATAATATCCATTGGATTCCTAGGGTTTATTGTATGAGCCCACCATATATTCACAGTCGGAATAGACGTTGACACACGAGCCTACTTTACATCAGCTACTATAATTATTGCTATTCCAACTGGAGTAAAAGTCTTCAGTTGATTAGCCACGCTTCACGGAGGCAGTATTAAGTGGTCTCCCGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTCGGAGGCTTAACCGGAATCGTGCTAGCTAACTCCTCCCTTGACATTGTTCTTCACGACACATATTACGTAGTTGCACATTTCCACTATGTACTGTCAATGGGGGCTGTGTTCGCTATCATAGGGGGATTTGTACACTGATTTCCACTGTTTTCAGGCTATACCCTAAATGAAACATGAGCCAAAATCCACTTTGCGATTATATTTGTAGGTGTAAATATAACTTTCTTTCCGCAACACTTCCTAGGACTATCCGGCATGCCACGACGATATTCTGACTATCCAGATGCATACACAATATGAAACACCATTTCATCTATAGGCTCATTTATCTCACTAACAGCTGTTATGCTAATAATTTTCATTATCTGAGAAGCCTTTGCATCCAAACGAGAAGTCCTAACTGTAGACCTTACCACAACAAACCTAGAGTGACTAAACGGATGCCCTCCCCCATATCACACATTTGAAGAACCTACATATATCAACCTAAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ourebia ourebi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The combination of continued agricultural and urban development, bush encroachment and increased vulnerability to poachers threatens the persistance Ourebia ourebi.

Protected areas (parks, wildlife refuges) exist to provide a safe environment for this species. The IUCN has listed the species as "Lower Risk, but Conservation Dependent." This means that if current conservation efforts were ended, the species would be in greater danger of extinction.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
IUCN SSC Antelope Specialist Group

Reviewer/s
Mallon, D.P. (Antelope Red List Authority) & Hoffmann, M. (Global Mammal Assessment)

Contributor/s

Justification
Listed as Least Concern as the total population is estimated at c. 750,000, 50% of which were in protected areas and stable in many of them, while populations outside protected areas were gradually declining. If current trends continue, some of the Oribi’s marginal populations may face eventual extinction. However, the species’ overall conservation status should remain satisfactory as long as it continues to exist in healthy, stable populations in a large number of protected areas and hunting zones and in some other areas with low densities of settlement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The oribi is classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1). Two subspecies are recognised: Haggard's oribi (Ourebia ourebi haggardi) is classified as Vulnerable (VU) and the Kenya oribi (Ourebia ourebi kenyae) is classified as Extinct (EX) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Oribi are locally common in suitable habitats at densities of 2-10 animals/km², but have been recorded at densities up to 45 animals/km² in exceptionally productive tropical grasslands and treeless floodplains (Brashares and Arcese in press, and references therein). Densities estimated from ground counts range from 0.1-0.4/km² in areas where it is uncommon or depleted (East 1999).

East (1999) produced a total population estimate of 750,000. Population trend is stable in many protected areas but decreasing in some others which receive minimal or no protection. Outside protected areas, population trend is gradually downwards in many parts of the Oribi’s range as human populations increase and settlement expands, although its populations are stable in some thinly settled, unprotected regions where hunting pressures are relatively low.

The total numbers of Haggard’s Oribi are probably in the thousands.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It has been eliminated from substantial parts of its former range by the spread of agricultural settlement, livestock and increased hunting for meat. In the Comoé N.P. in Côte d’Ivoire, Oribi experienced a decline of around 92% between 1978 and 1998 primarily due to poaching (Fischer and Linsenmair 2001). It nevertheless shows considerable resilience to hunting in some parts of its range, although generally not to the extent of highly resilient species such as Bushbuck and Grey Duiker. Its populations are becoming increasingly fragmented as it is gradually eliminated from moderately to densely settled areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The oribi is intensively hunted for food and its habitat is threatened by the development of human settlements (1) (2), resulting in numbers and distribution of this small antelope being greatly reduced (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its distribution and abundance are increasingly centred on protected areas (about half the total population occurs in and around protected areas) and some other areas where human population densities are very low, such as Niokolo-Koba (Senegal), Comoe (Ivory Coast), Arly-Singou and Nazinga (Burkina Faso), Mole and Bui (Ghana), Pendjari (Benin), eastern Salamat (Chad), Bouba Ndjida, Benoue, Faro and adjoining hunting zones (Cameroon), Manovo- Gounda-St. Floris, Sangba and adjoining hunting zones (Central African Republic), Garamba, Upemba and Kundelungu (Congo-Kinshasa), Omo (Ethiopia), Murchison Falls, Lake Mburo and Kidepo Valley (Uganda), Masai Mara and Ruma (Kenya), Serengeti (Tanzania), Kafue, Bangweulu and Liuwa Plain (Zambia) and Golden Gate Highlands N. P. (South Africa).

Haggard’s Oribi occurs in Boni-Dodori National Reserve in Kenya and Bush Bush N.P. in Somalia, but there is no information available on its status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The oribi is found in several protected areas throughout its range, including Comoé National Park in Cote d'Ivoire and Serengeti National Park, Tanzania (5), and is the subject of a WWF Species Project (6). This project aims to track captive-bred oribi after their release into appropriate habitat to research their home ranges and their habitat preferences. The long-term aim of the project is to establish viable wild populations from captive-bred stock (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Ourebia ourebi occasionally cause damage to field crops such as wheat and oats because these foods resemble their natural diet (Kingdon, 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ourebia ourebi is hunted for food and by recreational hunters.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Oribi

Oribi (Ourebia ourebi, known as oorbietjie in Afrikaans) are graceful slender-legged, long-necked small antelope found in grassland almost throughout sub-Saharan Africa.

Description[edit]

Oribi grow to around 92–110 cm (36 to 43 in) in length, with a shoulder height of 50–66 cm (20 to 26 in) and weigh an average of 12–22 kg (26 to 49 lb). They can run at speeds of up to 40–50 km/h (25–31 mph). In captivity, they have lifespans of up to 14 years.

The back and upper chest is yellow to orange-brown. The chin, throat, chest, belly and rump are white. The tail is short and bushy, the upper side black or dark brown, and the under surface white. The white, crescent-shaped band of fur above the eye helps to distinguish this species from other similar-looking antelope. Below each ear is a large, round, black, glandular patch, the nostrils are prominently red, and on the sides of the face are vertical creases that house the preorbital glands. These glands produce an odorous secretion used to mark the oribi's territory. Only males grow horns, which are slender and upright, ridged to about halfway up, the ends being smooth and pointed, with some of length 19 cm (7.5 in) being recorded.

Distribution and habitat[edit]

Oribi are found in most countries throughout sub-Saharan Africa, ranging from Senegal to west and central Ethiopia and southern Somalia, southward into eastern Kenya, across into north Botswana, Uganda, and Angola, with patchy and discontinuous distribution through Mozambique, Zimbabwe and into central and eastern South Africa.

They typically inhabit open grasslands or thinly bushed country, preferring habitats with short grasses on which to graze, interspersed with tall grasses which provide cover from predators and the elements. Oribi are highly water-dependent and tend to avoid steep slopes.

Reproduction[edit]

During the breeding season, August to December, the male will mate with all the females which share his territory. Usually, only one or two females are present in each territory. Following a gestation period of six to seven months, a single offspring is born. For the first eight to 10 weeks the female oribi hides her young in thick grass, where it will lie motionless if approached. The mother returns periodically to suckle her offspring. Young are weaned at about four to five months. Females reach sexual maturity at 10 months, males at 14 months.

Diet[edit]

Primarily grazers, oribi prefer to eat short grasses, but will browse on leaves, foliage and young shoots during the dry season. They are often seen in burnt areas after veld fires, returning to the area to eat the fresh grass shoots. The oribi also use mineral licks to supplement their diets.

Predators[edit]

Oribi fall prey to numerous animals, including lions, leopards, caracals, hyenas, African wild dogs, jackals, crocodiles and pythons. Young are also taken by eagles, genets and other small carnivores.

Behaviour[edit]

Oribi are found on their own, in pairs, or in small groups of one male with two or more females. Resting during the heat of the day, oribi are most active in the morning, late afternoon and evening. When alarmed, they produce a shrill whistle. Often, they do not attempt to flee until an intruder is within a few meters, remaining motionless in the grass, relying on camouflage. If threatened, they gallop away, bounding stiff-legged into the air every few strides; a behaviour known as stotting.

Threats and conservation[edit]

Oribi populations in many areas are threatened by human activities, such as:

  • Habitat destruction - Grasslands are lost to expanding settlement, commercial forestry, intensive commercial farming, grassland degradation due to overstocking, poor use of fire, erosion and mining.
  • Illegal hunting - Trapping with snares and hunting with dogs are serious threats, and has led to the demise of many oribi populations in South Africa.
  • Inappropriate management - In many areas where oribi are present, farm management practices (impenetrable fences, poor burning practices, poor veld management, domestic dogs) do not allow oribi to coexist. Sport hunting of oribi at unsustainable levels also threaten their survival.

Oribi occur in several protected areas and are the subject of a WWF Species Project. This project aims to track captive-bred oribi after their release into appropriate habitat to research their home ranges and habitat preferences. The long-term aim of the project is to establish viable wild populations from captive-bred stock.

Subspecies[edit]

These subspecies have been described:

Two of these subspecies are listed on the IUCN Red List: Haggard's oribi (O. o. haggardi) is classified as Vulnerable (Vu C1) and the Kenya oribi (O. o. kenyae) is classified as Extinct.

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Ourebia ourebi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!