Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

Occurs in eastern Mongolia and adjacent areas of Russia and north-eastern China. Smaller populations are still found in central and western Mongolia. There is a translocated population on Homin Tal steppe in Zavkhan Province of west-central Mongolia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Until the 1950's, Procapra gutturosa was found throughout most of Mongolia and the adjacent regions of Kazakhstan, the Russian Federation and China. This is an area of about 1.2 million square kilometers. Now the species is found only in the eastern portion of this range, in an area of less than 400,000 square kilometers.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Leimgruber, P., W. McShea, C. Brookes, B. Lhamsuren, C. Wemmer. 2001. Spatial patterns in relative primary productivity and gazelle migration in the Eastern Steppes of Mongolia. Biological Conservation, 102(2): 205-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Mongolian gazelles measure from 1 to 1.3 m from head to rump and stand about 75 cm tall at the shoulder. Males weigh around 30 kg and females about 25 kg. Fawns weigh 2.8 to 3.0 kg when they are born and measure 51 to 56 cm from head to rump. The summer coat is orange-buff, the flanks are pinkish-cinnamon, and the belly is white with a long haired dewlap. The winter coat is paler. During the rut, the males have swollen throats. Only males have horns, and these range in length from 225 to 355 mm.

Range mass: 25 to 30 kg.

Range length: 1.3 to 1 m.

Sexual Dimorphism: male larger; ornamentation

  • Gao, Z., Z. Jiang, S. Takatsuki, J. Kuh. 1998. The present status, ecology and conservation of the Mongolian gazelle, Procapra gutturosa: a review. Mammal Study, 23(1): 63-78.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Procapra gutturosa
Catalog Number: USNM 175179
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): T. Lyman
Year Collected: 1912
Locality: Bain-Chagan Pass, S End, Suok Plains; Little Altai, Mongolia, Asia
  • Type: Hollister, N. 1913 Feb 08. Smithsonian Miscellaneous Collections. 60 (19): 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits rolling arid steppes and plains. Mongolian gazelle move constantly over their range, except during the rutting and birthing seasons.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procapra gutturosa live in a semi arid, cold, temperate zone. Mongolian gazelles prefer flat or undulating steppes and dry grasslands.

The region where this species occurs features cold winters (with temperatures of -30 degrees Celcius). The growing season is short and it is dry throughout most of the year. Continuous snow cover lasts from 120 to 180 days of the year. Spring can be very windy and summers are relatively wet and hot (with temperaturs of up to 40 degrees Celcius).

The frostless summer period is 80 to 120 days. The annual rainfall is 250 to 380 mm. The gazelles live in cool temperate tall grasslands. The growing season in these areas is from early May to the end of September. The dormant season is from October until April. Snowstorms and heavy snow accumulation are common. The main natural calamities that the gazelles face are snow, snowstorms and frostbite.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland

  • Jiang, Z., S. Takatsuki, J. Li, W. Wang, J. Ma. 2002. Seasonal variations in food and digestion of Mongolian gazelles in China. Journal of Wildlife Management, 66(1): 40-47.
  • Reading, R., S. Amgalanbaatar, L. Lhagvasuren. 1998. Biological assesment of Three Beauties of the Gobi National Conservation Park, Mongolia. Biodiversity and Conservation, 8(8): 1115-1137.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Mongolian gazelles are small ruminants, but they are classified as intermediate feeders. Intermediate feeders are ruminants that are morphophysiologically intermediate between grazers and browsers. This classification is arrived at based on the ratio of the weight of ruminoreticular contents to body weight and the length of the total intestine relative to body length, as well as the ratio of the length of the small to the large intestine.

Mongolian gazelles have apparently adopted a digestive strategy similar to that of browsers, possibly because of their small body size. This allows them to adapt more easily to the environmental factors. They can regulate their digestive system in response to seasonal changes in food quality.

During autumn and winter they have the ability to digest fibrous foods more efficiently than other seasons. During the dormancy months, their digestive system holds more, and holds it for a longer time, allowing them to digest food more completely. This helps the gazelles to compensate for poor food quality and low food availability.

During dormancy, the grasses they feed upon are lower in levels of protein than ungulates typically require. But during this time of year, the gazelles must still subsist on grasses and other lower quality foods. They prefer higher quality foods when they are available. In spring they eat Artemisia spp., peashrubs, onions and legumes. During the summer onions comprise 80% of the diet. Lightly grazed areas have more nutritional forbs than do moderately or heavily grazed areas, however, lightly grazed areas are usually around towns and villages and not readily utilized.

Mongolian gazelles also have abundant microorganisms that help them to recycle nitrogen for protein synthesis, and to supplement the nitrogen shortage of food during autumn and winter.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts

Primary Diet: herbivore (Folivore )

  • Takatsuki, S., Z. Jiang, J. Li, W. Wang, J. Ma. 2002. Feeding type and seasonal digestive strategy of Mongolian gazelles in China. Journal of Mammology, 83(1): 91-98.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

No information is available on the ecosystem roles provided by Mongolian gazelles. They provide food for a variety of animals and given the large numbers in which they travel, are likely to have an impact on plant communities where they graze.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The main predators of Mongolian gazelles are wolves (Canis lupus), domestic dogs (Canis familiaris), and steppe eagles. Manul (Felis manul), red fox (Vulpe vulpes), kites, and vultures also prey on newborn fawns. Wolves attack the gazelles during late winter and spring, particularly after rut when males are exhausted and unable to run for long periods. In early summer, wolves attack pregnant females.

The main defenses these animals have against predation seem to be related to predator swamping. Females give birth to their young in synchrony each spring, apparently allowing more of the young to survive. Also, Mongolian gazelles herd together in especially large groups at the time of calving.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Procapra gutturosa is prey of:
Accipitridae
Canis lupus
Vulpes vulpes
Otocolobus manul
Aquila nipalensis
Canis lupus familiaris

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

No information is available on the communication of Mongolian gazelles. However, generalizations can be made, because they are diurnal mammals. They are likely to communicate with visual signals and body postures. Vocalizations are probably present. Scent cues may be important in mating and between mother an offspring. Undoubtedly, tactile communication is also important in such interactions.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Male Mongolian gazelles live about 7.5 years and females live 9.5 years, which is considerably less than other related ungulates. The shortened longevity of this species is partly because of quick tooth wearing.

The survival rate of fawns in their first summer is 80%. Because of the high rate of pregnancy and of fawn survival, the rate of increase of the populations sometimes reaches 20 to 25%.

Predation, periodic epidemics, and severe winters are the main causes of death for members of this species. Mongolian gazelles suffer from "foot and mouth disease" and Pasteurellosis, as well as unknown diseases. Heavy snows and food shortages in the winter sometimes cause losses of one third to half of a Mongolian gazelle population.

Average lifespan

Status: wild:
0 years.

Average lifespan

Status: captivity:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (captivity) Observations: One wild born specimen was about 12 years old when it died in captivity (Richard Weigl 2005). Tooth erosion appears to be a major life-limiting factor and explain why these animals live less than other similar species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mongolian gazelles are polygynous with one male gathering about 13 females. Rutting occurs in mid-November to early February. During the rut, males battle with each other though the fighting is not serious.

Mating System: polygynous

Mating occurs during the rut, from mid-November through February. The birthing season follows in mid-June to mid-July, indicating a gestation period of about 7 months. Fawns are born singly, with twins occuring rarely (2.5 to 8.2%). The pregnancy rate of females older than 1.5 years is between 90% and 100%. The birthing season is quite variable and depends on the climatic conditions during the previous year.

During the two weeks of calving, females herd up to a density of 40,000 females per 35 square kilometers. Ninety percent of the females in a herd will give birth within a 4 day period. This birth synchrony is a strategy the species has developed to combat the short growing season and the effectiveness of predators. Females must have their young at about the same time to allow the young to reach a minimum body size by the onset of winter. Birth synchrony is also a strategy called predator swamping. If all the females have their young at one time, there will be so many that some will be able to avoid predation.

Females reach sexual maturity at 1.5 years old, whereas males mature sexually at about 2.5 years old.

Breeding interval: These animals breed once yearly.

Breeding season: Rutting occurs from mid-November to early February. Birthing occurs in mid-June to mid July.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 7 months.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 2.5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 2900 g.

Average gestation period: 185 days.

Average number of offspring: 1.3.

Average age at sexual or reproductive maturity (female)

Sex: female:
532 days.

As in many mammalian species, parental care seems to be primarily a female affair. Females provide milk, grooming, and protection to their fawns. Fawns stay with their mothers in the herd for about one year and stay with the herd until they have reached sexual maturity.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents

  • Gao, Z., Z. Jiang, S. Takatsuki, J. Kuh. 1998. The present status, ecology and conservation of the Mongolian gazelle, Procapra gutturosa: a review. Mammal Study, 23(1): 63-78.
  • Leimgruber, P., W. McShea, C. Brookes, B. Lhamsuren, C. Wemmer. 2001. Spatial patterns in relative primary productivity and gazelle migration in the Eastern Steppes of Mongolia. Biological Conservation, 102(2): 205-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Procapra gutturosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTTTCAACCAACCATAAAGACATTGGTACCCTATATCTCCTATTTGGTGCCTGAGCTGGCATAGTAGGAACCGCCCTAAGCCTATTGATTCGTGCTGAATTAGGTCAACCCGGAACCTTACTTGGAGATGACCAAATCTATAATGTAGTCGTAACTGCACATGCATTTGTAATAATTTTCTTTATGGTAATGCCTATTATAATTGGAGGCTTCGGTAACTGACTAGTTCCCCTAATAATTGGTGCCCCTGACATAGCATTTCCCCGAATAAACAATATAAGTTTTTGACTCCTCCCTCCCTCTTTTCTTCTGCTTCTGGCATCTTCTATAGTTGAAGCGGGTGCAGGCACAGGTTGGACTGTATATCCCCCTCTAGCGGGCAATTTAGCCCACGCAGGGGCCTCAGTAGACCTGACTATCTTCTCTCTTCACTTAGCAGGTGTTTCTTCCATCTTAGGGGCTATTAACTTTATCACAACAATTATTAATATAAAACCTCCCGCAATATCACAATATCAAACTCCTTTATTCGTATGATCCGTTATAATTACTGCCGTGCTATTACTTCTCTCACTTCCTGTACTAGCCGCAGGCATTACTATGCTCTTAACAGACCGAAATCTAAATACAACTTTCTTCGATCCAGCAGGAGGGGGCGACCCTATTCTATACCAACACTTATTTTGATTCTTTGGACATCCTGAAGTATATATTCTCATTTTACCCGGATTTGGAATAATCTCCCACATCGTCACCTACTACTCAGGCAAAAAAGAACCATTTGGGTATATAGGAATAGTATGAGCCATAATATCAATTGGATTTCTAGGGTTTATTGTATGGGCTCACCATATATTTACAGTTGGAATAGACGTTGACACACGAGCCTATTTTACATCGGCCACTATAATTATCGCCATTCCAACCGGAGTAAAAGTCTTTAGTTGACTAGCCACACTCCACGGAGGCAATATTAAATGATCTCCCGCTATAATATGAGCACTAGGCTTCATTTTCCTTTTTACAGTTGGAGGCCTAACTGGAATTGTCCTGGCCAACTCCTCTCTTGATATCGTCCTTCACGACACGTATTATGTAGTTGCACATTTTCATTATGTACTATCAATAGGAGCCGTATTTGCTATTATGGGAGGATTCGTACACTGATTTCCATTATTTTCAGGCTACACCCTCAACGACACATGAGCTAAAATCCATTTTGCAATTATGTTTGTAGGTGTAAATATGACCTTTTTTCCACAACACTTCCTAGGATTATCTGGCATACCACGACGATACTCTGATTACCCAGACGCATATACAACATGAAACACTATCTCATCCATAGGCTCATTTATTTCACTAACAGCAGTCATGCTAATAGTTTTTATTATCTGAGAGGCATTCGCATCTAAACGGGAAGTCTCAACTGTAGACCTCACCACAACAAACTTAGAGTGATTAAACGGATGCCCTCCACCATATCACACATTCGAAGAGCCCACATACGTAAACCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Procapra gutturosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Plowman, A. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Population estimates over the last 10 years have ranged from 400,000 to 2,700,000. The taxon is subject to population fluctuations due to disease and effects of severe winter conditions. Illegal hunting is heavy, in addition to the legal annual harvest. However, several recent authorities agree on a figure of approximately 1,000,000 and the range is expanding towards the north-west. Annual monitoring of the status of this species is required as an upsurge in illegal hunting in conjunction with adverse climatic conditions or outbreak of disease could result in a sharp fall qualifying for a classification of Near Threatened or Vulnerable.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mongolian gazelles used to be the most numerous wild ungulate of the grassland region of China. They were a significant component of the grassland ecosystem. The population has decreased dramatically and now faces extirpation in China. In the 1940s, the population was about 1,500,000. Today it is just 300,000 to 500,000. This is a result of grassland degradation (total grass production has dropped by 30%) due to human expansion, agricultural development, and overgrazing since the 1960s.

The decline in Mongolian gazelle populations can also be attributed to over-hunting and desertification. Poaching is a problem for this species, with poachers shooting more rutting males and more pregnant and lactating females after the legal hunting period, because they are easier to shoot. The reduction of pregnant females results in decreased fecundity and the reduction of reproductive males results in unhealthy sex ratios.

In 1989, the Chinese government listed Mongolian gazelles under its wildlife protection law as a Class II species for conservation. Under this law, nature reserves are supposed to be established, and inspection of habitat condition is to be made regularly. Construction projects which degrade the habitat, and trading of the gazelles and their parts, are to be controlled. Hunting is prohibited, and poaching can be prosecuted under criminal law.

In Mongolia, hunting has been controlled since 1932 and in 1995 a new hunting law was introduced to help reduce poaching.

In the Russian Federation's "Red Data Book", the Mongolian gazelle is listed as a 'disappearing species.'

Because the species migrates between China and Mongolia, any conservation program requires cooperation and coordination between these countries. It is recommended that the open season for hunting Mongolian gazelles be limited to the time of greatest meat quality, and hunting intensity be limited to 19% of the total population. Because of the high reproductive capacity of the species, populations would be able to recover quite quickly despite continued hunting, providing that poaching is controlled.

The International Union for Conservation of Nature and Natural Resources lists the Mongolian gazelle as a lower risk species that is near threatened. They list the species major threats as human induced habitat loss and degradation and harvesting.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population estimates over the last 10 years have ranged from 400,000 to 2,700,000. The taxon is subject to population fluctuations due to disease and effects of severe winter conditions. Illegal hunting is heavy, in addition to the legal annual harvest. However, several recent authorities agree on a figure of approximately 1,000,000 in Mongolia, though some experts still believe this figure is much too high. Most of the current population is found in the eastern Mongolian steppes. Smaller populations are found in central and western Mongolia. Some move south into China in winter where up to 250,000 may occur. Around 80,000 are estimated to live year-round in China.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Illegal hunting (in addition to the legal harvest) is an increasing threat. The species is harvested for meat and hides. Former tight control in Mongolia has weakened during the last decade and tens of thousands are killed illegally on top of the official harvest.

The Ulaanbaatar-Beijing railway is double-fenced and has effectively cut off the smaller populations from the core population in eastern Mongolia. Outbreaks of disease and severe winters result in sporadic heavy mortality.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in some protected areas in Mongolia but most of the population occurs outside these. Given some legal protection in Mongolia and China, but enforcement is not fully effective. Currently proposed for inclusion on the appendices of the Convention on the Conservation of Migratory Species of Wild Animals (CMS).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Mongolian gazelles on humans. However, they carry foot and mouth disease, which could potentially be transmitted to domestic animals.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mongolian gazelles are an important souce of food for manylocal peoples, and are heavily hunted, both legally and illegally.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mongolian gazelle

The Mongolian gazelle (Procapra gutturosa), or dzeren (Russian: Дзерэн), is a medium-sized antelope native to the semiarid Central Asian steppes of Mongolia, as well as some parts of Siberia and China. The name dzeren is Russian corruption of the Mongolian language name of zeer' (Mongolian: Зээр).

In the summer, its coat is light brown with pinkish tones, becoming longer and paler during the winter. It also has a distinctive heart-shaped white patch on their rump area, divided by a median line of darker color. The males have lyre-shaped horns which curl backwards from the forehead. They are extremely fast runners and good swimmers.

Historical (light green) and present range (dark green)

In the winter, they are mostly diurnal, but in the summer, they are active shortly after sunrise and before sunset. They tend to travel a lot, and migrations takes place in spring and autumn, but the distance and direction vary depending on the weather and food availability.

The groups usually consists of 20-30 individuals in the summer, and 100 in the winter. However, herds up to 5,000 individuals are not unusual. They still exist in large numbers, with a small captive population; the population trend is unknown. In 2007, a mega-herd of a quarter of a million Mongolian gazelles was seen gathering on the country's steppes, one of the world's last great wildernesses.[2]

The mating season is in the late autumn or winter; at this time the males' throat swells in a goiter-like effect. Competition is vigorous, but fights rarely breaks out. The gestation period lasts for about five or six months. Births occur is June and July, when groups of dozens of females separate from the herd to give birth, rejoining the herd afterward. They usually give birth to a single young and occasionally twins. They weigh about 3 kg and can keep up with their mother after a few days. They will be able to mate after 17 – 18 months.

The Mongolian gazelle is still one of the most numerous large animals in the world, with the total population at about 1.5 million individuals, but approximately 100,000 are killed each year. However, it does not seems to be hit particularly hard and the conservation status is at Least Concern. Whether the population is increasing or decreasing is unknown, but the population is known to be subject to significant fluctuations due to diseases and severe winters.

References[edit]

Notes[edit]

  1. ^ Mallon, D.P. (2008). Procapra gutturosa. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ BBC: Largest herd of gazelles sighted
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!