Overview

Brief Summary

Biology

Mating occurs in November and December (2), at this time males fight fiercely in an effort to control access to groups of 10 – 20 females (4). Females migrate north to give birth, over 300 km away, in June and July (2). A single calf is usually born, although life expectancy is extremely low in this harsh environment (2). Tibetan antelope are extremely wary and alert; partially concealed, they rest in depressions dug into the soil, which provide protection from mountain winds and predation (4). Herds mainly browse in the morning and evening, resting at midday (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Tibetan antelope, or 'chiru', is well known for possessing the finest and warmest wool in the animal kingdom. This adaptation provides warmth in the harsh climate of the Tibetan plateau but has contributed greatly to this species' decline (2). These antelope are most closely related to wild sheep and goats, they have grey to reddish-brown coats with a remarkably soft and dense undercoat (2). The underparts are creamy white in colour and the bulbous nostrils have small inflatable sacs on the side (4). Male Tibetan antelope have slender, black horns that may reach 60 centimetres in length; in winter they possess black markings on the face and legs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Formerly ranged across the whole Qinghai-Tibet Plateau, China. Range decreased and now absent from all or most of the eastern plateau; the main stronghold of the species is in the remote Chang Tang area of north-western Tibet (Schaller 1998). A small number occur seasonally in northeast Ladakh, in the extreme north of India. Formerly occurred in a small area of northwest Nepal (Schaller 1977).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pantholops hodgsonii (also known as the Tibetan antelope and Chiru (Department of Interior 2000) is endemic to the Tibetan Plateau. It is found between Ngoring Hu in China and the Ladakh region in India (Tibetan Plateau Project 2001a). The Chiru range once extended to western Nepal, but none have been seen in Nepal for several years and the species is presumed to be extirpated from that region (Department of Interior 2000).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
China, India, Nepal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the Tibetan Plateau, this antelope is found mainly in Chinese regions although some individuals migrate to Ladakh in India (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Chiru range in size from 35-50 inches in height (Tibetan Plateau Project 2001a) and weigh between 26-40 kg (Massicot 2001). Adult males develop long, straight horns up to 23 inches in length, while females are hornless (Tibetan Plateau Project 2001a). Chiru coat coloration varies from beige and grayish to whitish, with black markings on the face and legs (Wildlife Conservation Society date unknown).

Range mass: 26 to 40 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabit high altitude plains, undulating hills plateaux and montane valleys at elevations of 3,700-5,500 m (Schaller 1998). Most populations are highly migratory or nomadic (Schaller 1998; Schaller et al. 2006), moving hundreds of kilometres between summer and winter ranges. Some populations migrate over much shorter distances (Harris and Miller 1995). Males and females are usually separate except for the mating period. Females congregate to give birth in traditional birthing grounds, some of which e.g. Central Kunlun have only recently been identified. The ecological parameters of these sites are not fully understood.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Chiru are most often found along the alpine steppe in northwest Tibet and China, where annual precipitation is less than 16 inches and elevations are between 13,000-18,000 feet (Massicot 2001). Chiru prefer flat or gently rolling topography, but are also known to inhabit high rounded hills and mountains (Massicot 2001).

Range elevation: 4,300 to 6,000 m.

Habitat Regions: temperate

Terrestrial Biomes: mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Tibetan antelope inhabits harsh steppe areas at elevations of 3,700 to 5,500 metres above sea level (4), where temperatures can fall to -40°F (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Chiru is considered a grazer and possibly a browser (Schaller, 1998); however, there is little information on the diet of Chiru.

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

There are no known predators of Chiru, although Schaller (1996) hypothesized that one reason females migrate north to calving grounds may be to avoid wolves during pregnancy and birth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

According to Schaller (1998), the maximum age of a Chiru in the wild is about 8 years.

Range lifespan

Status: wild:
8 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During the mating season, Chiru males attempt to form harems of 10 to 20 females (Massicot 2001). Although apparently non-territorial, males violently defend their harem against competing males (Schaller, 1996). When a female approaches a male, the male prances around her with his head held high (Schaller, 1996). If the female does not flee, the male then mates with her (Schaller, 1996). After mating, females leave the males, and there is no apparent bond between sexes (Massicot 2001).

Mating System: polygynous

Conception among female Chiru begins at 1.5-2.5 years of age (Massicot 2001). The gestation period lasts between 7-8 months, at which time the female gives birth to a single calf, usually after mid-June to early July (Massicot 2001).

According to Schaller (1998), mortality among young is high. Within the first two months of birth, up to half of Chiru young die; and 2/3 die before two years of age.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 7 to 8 months.

Range age at sexual or reproductive maturity (female): 1.5 to 2.5 years.

Range age at sexual or reproductive maturity (male): 1.5 to 2.5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Young males stay with their mother for one year, at which time they leave and join with other males (Schaller, 1996). Female young typically stay with their mother well after their first year and accompany them during migration to the calving grounds to the north (Schaller, 1996, Massicot 2001).

Parental Investment: female parental care ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pantholops hodgsonii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0444-06|DQ191826|Pantholops hodgsonii| AATCGCTGATTATATTCAACTAACCATAAAGACATTGGCACCCTGTACCTGTTATTCGGCGCCTGAGCTGGCATGGTAGGAACTGCCCTA---AGCCTACTAATTCGCGCTGAACTAGGCCAACCCGGGACTCTTCTTGGAGAT---GACCAAATCTATAATGTAGTTGTAACCGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTCGGCAATTGGCTAGTCCCTCTGATA---ATTGGAGCCCCTGATATAGCATTCCCTCGGATAAACAATATAAGCTTTTGACTTCTTCCCCCTTCCTTCCTGTTACTCCTAGCATCTTCTATAGTTGAAGCTGGAGCAGGAACAGGCTGGACCGTATACCCCCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCCTCAGTTGACCTG---ACTATCTTCTCCCTACACCTGGCAGGAGTCTCCTCAATTCTAGGAGCCATTAATTTTATTACAACTATTATTAATATAAAACCCCCTGCAATATCACAATATCAAACCCCTCTATTTGTATGATCAGTATTAATTACTGCCGTATTACTCCTCCTTTCACTTCCTGTACTAGCAGCC---GGCATTACAATGCTATTAACAGACCGAAACCTGAACACAACCTTCTTCGATCCGGCAGGAGGAGGAGACCCCATCCTATATCAACACTTGTTCTGATTTTTTGGACACCCTGAAGTATACATTCTTATTTTACCTGGATTTGGAATAATCTCCCATATCGTAACCTACTATTCAGGAAAAAAA---GAACCATTTGGATATATAGGAATAGTATGAGCCATGATATCAATTGGATTTCTAGGATTTATTGTATGAGCCCATCACATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pantholops hodgsonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2d

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Plowman, A. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Numbers and distribution have both decreased sharply, mainly as a result of commercial hunting for the underfur. Improved protection measures have slowed the rate of illegal hunting though it is still a factor. The decline is estimated to have exceeded 50% and continuing over a period of 3 generations (est. 18-20 years, 1983-2003). Recently reported improvements in its overall conservation situation indicate the potential for a possible revised uplisting.

History
  • 2003
    Endangered
    (IUCN 2003)
  • 2000
    Endangered
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Historic population estimates are inaccurate, but there are several documented sightings of large herds in several areas by western explorers (Department of Interior 2000). Rawling (1905), cited in Schaller (1998) wrote the following excerpt regarding herd size:

"Almost from my feet away to the north and east, as far as the eye could reach, were thousands upon thousands of doe antelope with their young… Everyone in camp turned out to see this beautiful sight, and tried, with varying results, to estimate the number of animals in view. This was found very difficult however, more particularly as we could see in the extreme distance a continuous stream of fresh herds steadily approaching: there could not have been less than 15,000 or 20,000 visible at one time."

Although the data on population dynamics is incomplete, it is clear that the total population has declined during the past 30 years. According to the IUCN (2000), population estimates between 1950-1960 ranged from 500,000 to 1 million individuals; however, a population study conducted by R. East in 1993 revealed a population size of slightly greater than 100,000 (Massicot 2001). In 1998, Schaller (1998) released a paper that estimated total population numbers to be less than 75,000 individuals.

There are a number of reasons for the decline of Chiru. According to the 2000 Federal Register (Department of Interior 2000), one cause of population decline may be due to loss of habitat from increased human activity in the Tibetan Plateau, such as infrastructure development, pastoral settlements, rangeland conversion for livestock grazing, and natural resource extraction.

A second reason for declines in Chiru populations can be attributed to adverse weather. The Tibetan Plateau is an extreme landscape characterized by harsh weather, which can lead to starvation among Chiru populations (Department of Interior 2000). Those most adversely affected by this weather are females and young, presumably because they are smaller and more susceptible to the cold and lack of food resources (Department of Interior 2000).

Although loss of habitat and adverse weather certainly contribute to population declines, the most serious threat to the Chiru is poaching (Department of Interior 2000, Massicot 2001). According to the 2000 Federal Register (Department of Interior 2000), approximately 20,000 males, females, and young are killed each year by poachers who value the Chiru for their wool, known in international markets as shahtoosh (meaning “from nature and fit for a king”). Shahtoosh fibers are extremely fine (1/5 that of human hair) and are considered the softest and warmest wool in the world (Tibetan Plateau Project 2001a).

In China, most poaching occurs in the Arjin Shan, Chang Tang, and Kekexili Nature Reserves (Department of Interior 2000). The most efficient way to collect shahtoosh is to kill chiru (Department of Interior 2000). There are no documented cases of capture-and-release of any Chiru, and reports that shahtoosh can be collected from shrubs where Chiru have brushed against them are false (Department of Interior 2000).

After killing the Chiru, poachers usually skin the animal immediately (Department of Interior 2000). The 2000 Federal Register (Department of Interior 2000) reports that the hides are then sold to dealers who prepare the shahtoosh. Shahtoosh is then smuggled out of China by truck or animal caravan through Nepal or India, and into the states of Jammu and Kashmir, the only two locations in the world where the possession and processing of shahtoosh is legal (Department of Interior 2000, Tibetan Plateau Project 2001a).

Once shahtoosh reaches Jammu and Kashmir, it is processed into expensive and fashionable shawls and scarves, then smuggled into European and United States markets (Department of Interior 2000), where they typically sell between $7,000-$15,000 each and are coveted by the rich and famous (Shahtoosh date unknown).

Approximately 4-5 ounces of shahtoosh can be processed from one Chiru carcass (Department of Interior 2000), and 3-5 hides are necessary to make one shawl (Tibetan Plateau Project 2001a).

In China, Chiru are Class 1 protected under the People’s Republic of China on the Protection of Wildlife law, which prohibits the killing of any chiru with the exception of written permission by the Chinese government. Under the Wildlife Protection Act of India, Chiru are listed as a Schedule I species. In 1975, it was listed as an Appendix II species under CITES until 1979 and moved to Appendix I status in 1979, where it remains at present.

The 2000 Federal Register (Department of Interior 2000) documents that any trade in shahtoosh is strictly prohibited under the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), as well as Indian and Chinese law.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/29/2006
Lead Region: Foreign (Region 10) 
Where Listed: entire


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Pantholops hodgsonii , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN – A2d) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Numbers were estimated at <75,000 by Schaller (1998). Following that, Feng (1999) estimated a population size of 100,000 to 120,000, while Xi and Wang (2004) guessed 150,000. However, these figures are speculative and rigorous population estimates over the entire Chiru range are urgently needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Chiru have long been hunted for their underfur (shahtoosh), which is renowned for its quality and which has traditionally been transported to Srinagar in Kashmir, where it is woven into an extremely fine fabric used to make shawls. This hunting escalated to a commercial scale in the late 1980s and 1990s, becoming the major threat to Chiru and leading to a severe decline in numbers (Wright and Kumar 1997). Measures to restrict illegal hunting and smuggling of the product have become increasingly effective, though the problem has not been eliminated. Horns of the males have also been traditionally used as gun rests, and to a limited extent in traditional Chinese medicine. Other important threats include expansion of livestock herding into remote and previously unused areas (Fox and Bårdsen 2005), road building (facilitating the above and illegal hunting), fencing of pastures on the Tibetan plateau, and construction of the Beijing-Lhasa railway which threatened to divide Chiru range. Engineering measures, including ?underpasses?, now appear to be having some beneficial effect. Chiru are also vulnerable to severe winter conditions. An exceptional snowstorm in Qinghai in 1985 caused high mortality and led to their disappearance from some areas especially in the eastern part of their range (Schaller and Ren 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Large herds of antelope previously roamed the Tibetan plateau, and they are the only large mammals native to this region. In the 1990s however, a worrying decline in numbers was recorded and the population was estimated to have fallen to around 75,000 animals (5), with as many as 20,000 individuals killed annually (2). The principal cause of this decline is to supply the 'shahtoosh' trade; the production of shawls made from the fine, warm wool of this species. Shahtoosh stands for 'king of wools' in Persian and became a sought-after fabric in the fashion capitals of the world towards the end of the 20th Century (6). Up to five antelope are needed to produce a single shawl and these can fetch up to US$ 15,000 on world markets (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on Appendix I of CITES. The Chiru is legally protected in China and India, but enforcement of the law over the vast area of its habitat has been problematic, but enforcement efforts have recently been intensified (Zhen 1999; China Daily 2004), public awareness of the Chiru within China has increased, and some populations have evidently begun to respond (Schaller et al. 2003). Occurs in Qiantang, Kekexili, Arjin Shan and Sanjiangyuan National Nature Reserves and Jung Kunlun provincial nature reserve. Since 2002, IFAW has organized and sponsored an annual workshop for nature reserve staff and other officials from the three Chinese provinces where the majority of the population is concentrated (Tibet, Qinghai, Xinjiang).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Tibetan antelope are protected by law in China, India and Nepal (2), and international trade is prohibited by their listing on Appendix I of the Convention on International Trade in Endangered Species (3). Until 2002, shahtoosh shawls were legally produced in the states of Jammu and Kashmir in India but a vital ban on manufacture has now been introduced (7). Widespread education and anti-poaching campaigns have been carried out and these have gone some way towards slowing the decline in this magnificent species (2). There is evidence that illegal trade still continues however (7) and conservation efforts must continue.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The wool, called shahtoosh, is very valuable (Tibetan Plateau Project 2001a).

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tibetan antelope

The Tibetan antelope or chiru (Pantholops hodgsonii) (Chinese 藏羚羊) is a medium-sized bovid which is about 80 centimetres (2.6 ft) in height at the shoulder. It is the sole species in the genus Pantholops and is placed in its own subfamily, Pantholopinae. It is native to the Tibetan plateau including China's Tibet Autonomous Region, Qinghai province, and Xinjiang Autonomous Region; and in Ladakh, Jammu and Kashmir region of India and Pakistan. The Tibetan antelope is also known commonly by its Indian English name, chiru. The coat is grey to reddish-brown, with a white underside. The males have long, curved-back horns which measure about 50 centimetres (1.6 ft) in length. There are less than 75,000 individuals left in the wild, down from a million 50 years ago.

Contents

Description

It was formerly classified in the Antilopinae subfamily, but morphological and molecular evidence led to separation of the Chiru in the monotypic Pantholopinae, closely allied to goat-antelopes of the subfamily Caprinae (Gentry 1992, Gatesy et al. 1992, Ginsberg et al. 1999).

Tibetan antelope are gregarious, sometimes congregating in herds hundreds strong. The females migrate up to 300 kilometres (190 mi) yearly to calving grounds in the summer where they usually give birth to a single calf, and rejoin the males at the wintering grounds in late autumn (Schaller 1998). Chirus live on the high mountain steppes and semi-desert areas of the Tibetan plateau such as Kekexili, where they feed on various forb and grass species. The average life span is about eight years.

Conservation

The antelope are killed for their wool, which is woven into the luxury fabric "shahtoosh," threatening the species’ survival.

Tibetan antelope are listed as endangered by the World Conservation Union and the United States Fish and Wildlife Service due to commercial poaching for their underwool, competition with local domesticated herds, and the development of their rangeland for gold mining. The Chiru's wool, known as shahtoosh, is warm, soft and fine. Although the wool can be obtained without killing the animal, poachers simply kill the chiru before taking the wool; the Chiru's numbers have dropped accordingly from nearly a million (estimated) at the turn of the 20th century to less than 75,000 today. The numbers continue to drop yearly. The struggle to stop illegal antelope hunting was portrayed in the 2004 film, Kekexili: Mountain Patrol.

In July 2006 the Chinese government inaugurated a new railway that bisects the Chiru's feeding grounds on its way to Lhasa, the Tibetan capital. In an effort to avoid harm to the animal, thirty-three special animal migration passages have been built beneath the railway. However, the railway will bring many more people, including potential poachers, closer to the Chiru's breeding grounds and habitat.

On February 22, 2008, The Wall Street Journal Online reported that China's state-run news agency, Xinhua, issued a public apology for publishing a doctored photograph of Tibetan antelope running near the Qinghai-Xizang railway. Liu Weiqing, a 41-year-old photographer, was identified as the author of the work. He had reportedly camped on the Tibetan plateau since March 2007, as part of a series by the Daqing Evening News, to raise awareness regarding the Tibetan bovid. He was also under contract to provide images to Xinhua. He has since resigned from Daqing Evening News.[2] Despite the impression given by the faked photo, the antelope are getting used to the Qinghai-Tibet Railway, according to a letter to Nature on April 17, 2008, from researchers of the Chinese Academy of Sciences.[3]

References

  • Gatesy, J., D. Yelon, R. DeSalle, and E. Vrba. (1992). "Phylogeny of the Bovidae (Artiodactyla, Mammalia), based on mitochondrial ribosomal DNA sequence." Mol. Biol. Evol. 9: 433–446.
  • Gentry, A. (1992). "The subfamilies and tribes of the family Bovidae." Mammal Review 22:1–32
  • Ginsberg, J. R., G. B. Schaller, and J. Lowe. (1999). "Petition to list the Tibetan antelope (Pantholops hodgsonii) as an endangered species pursuant to the U.S. Endangered Species Act of 1973." Wildlife Conservation Society and Tibetan Plateau Project.

Notes

  1. ^ Mallon, D.P. (2008). Pantholops hodgsonii. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 March 2009. Database entry includes a brief justification of why this species is of endangered.
  2. ^ Spencer, Jane (2008-02-22). "China Eats Crow Over Faked Photo Of Rare Antelope". The Wall Street Journal. http://online.wsj.com/article/SB120363429707884255.html?mod=yhoofront. Retrieved 2008-02-26. 
  3. ^ Yang, Qisen; Lin Xia (2008-04-17). "Tibetan wildlife is getting used to the railway". Nature. http://www.nature.com/nature/journal/v452/n7189/full/452810c.html. Retrieved 2008-04-29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!