Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)
Overview
Distribution
Range Description
This species is found in China (Upper Yangtze Gorge in west Sichuan and adjacent parts of Tibet and north Yunnan) (Grubb, 2005). Recently, populations have been reported from Deqin county, northwestern Yunnan (Wen Xiao, Dali University, unpublished data, 2007). Its primary range is in a narrow area along the Jinshajiang Valley, which forms part of the upper reaches of the Changjiang (Yangtse) river. Specimens have been collected from Batang (Sichuan), and Baiyu, to the north of Batang (Cai et al., 1990). Local hunters claim it is found in Derong (south-western Sichuan), in Deqin (north-western Yunnan), and in Markam (eastern Xizang); areas that are all to the west and south of Batang (Wu et al., 1990; Wang and Wang 2003). Wang et al. (2000) doubted the presence of dwarf blue sheep in Baiyu County (believing these animals to be blue sheep, as well as the reports of dwarf blue sheep from Markam (in eastern Tibet; Wang and Wang 2003). The status of dwarf blue sheep in Deqin County, Yunnan is in some dispute, and requires more investigation.
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
Dwarf blue sheep inhabit rugged valley terrain along the Yangtze River valley. They live among very steep rocky slopes between 2,700-3,200 m; occasionally range into conifer forest and forest clearings. Blue Sheep may live in same region at higher altitudes (Wu et al., 1990; Wang et al., 2000; Wang and Wang 2003; Shen et al., 2007). This valley habitat is dry with sparse vegetation cover; common species include grasses (Cymbopogon distans and Themeda hooderi), low shrubs (Berberis spp., Rosa spp., Cotoneaster spp., Cladrastis spp., Ephedra spp., and Rhododendron spp.), and clubmoss (Selaginella sanguinolenta) (Wang et al., 2000). P. schaeferi is isolated from the alpine habitat of P. nayaur by a belt of oak forest, in which they have not been documented to enter (Groves, 1978; Wang et al., 2000). Diet consists of grasses, low shrubs, club moss and lichens. They feed and rest alternately throughout the day on the grassy slopes of mountains. Group sizes were formerly 10-36 animals, but now usually less than 15, or even fewer as a result of over-hunting and competition with livestock. Males sometimes form all male groups or sometimes mix with females and young. The largest herd reported by locals was 25 animals, although this was seen in the 1950s (Wang et al., 2000). These same locals also stated that herd size has been declining since then - due primarily to hunting and competing with livestock, but also due to habitat loss. Contrary to Schäfer's original reports (1937), neither Wu et al. (1990) nor Wang et al. (2000) ever observed solitary individuals. Population densities range between 0.5-1.0 individuals per square kilometer (Wu et al., 1990; Wang and Wang, 2003).
These sheep are known to consume more than twenty species of plants (Wu et al., 1990); according to the observations made by Wang et al. (2000), they feed primarily on grasses (e.g., Pennisetum flaccidum and Setarica glauca), though other plants like club moss (Selaginella sanguinolenta) are also eaten. Predators include wolf (Canis lupus), dhole (Cuon alpinus), leopard (Panthera pardus), and large raptors (Wang et al., 2000).
Usually single young (rarely twins) are born in May or June after a gestation of 160 days. Young are weaned within six months and reach maturity at 1.5 years. Males may take seven years to reach full size (Wang and Hu 2004).
These sheep are known to consume more than twenty species of plants (Wu et al., 1990); according to the observations made by Wang et al. (2000), they feed primarily on grasses (e.g., Pennisetum flaccidum and Setarica glauca), though other plants like club moss (Selaginella sanguinolenta) are also eaten. Predators include wolf (Canis lupus), dhole (Cuon alpinus), leopard (Panthera pardus), and large raptors (Wang et al., 2000).
Usually single young (rarely twins) are born in May or June after a gestation of 160 days. Young are weaned within six months and reach maturity at 1.5 years. Males may take seven years to reach full size (Wang and Hu 2004).
Systems
- Terrestrial
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pseudois schaeferi
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ATGTTCATCAATCGCTGATTATTCTCAACCAACCATAAAGACATCGGCACCCTCTACCTCCTATTTGGTGCCTGAGCCGGTATAGTAGGAACTGCCTTAAGCTTATTAATTCGCGCTGAACTAGGCCAGCCCGGAACTCTACTTGGAGATGACCAAATCTACAATGTAGTTGTAACTGCACATGCATTCGTAATAATTTTCTTTATAGTAATGCCTATTATGATTGGAGGATTCGGCAACTGGCTAGTTCCTCTAATAATTGGAGCCCCTGACATAGCATTCCCTCGGATAAACAATATAAGCTTTTGACTCCTTCCCCCTTCTTTCCTGCTACTCCTAGCATCCTCTATAGTTGAAGCTGGAGCAGGAACAGGTTGAACTGTATATCCTCCCCTAGCAGGTAACCTAGCCCATGCTGGGGCCTCAGTAGACCTGACCATTTTCTCCCTACACCTAGCAGGTGTTTCCTCAATCCTAGGGGCCATTAATTTTATCACAACTATTATTAACATGAAACCCCCTGCAATATCACAGTATCAAACTCCCCTATTCGTATGATCCGTATTAATTACTGCCGTACTACTTCTCCTCTCACTTCCTGTATTAGCAGCTGGCATCACAATATTATTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTATATCAACATCTATTCTGATTCTTTGGACACCCTGAAGTATACATTCTTATTCTACCTGGATTTGGAATAATCTCCCATATCGTAACCTACTACTCAGGGAAAAAAGAACCATTTGGGTACATAGGAATAGTGTGGGCCATAATATCAATTGGATTTCTAGGATTTATTGTATGAGCCCACCATATATTTACAGTCGGAATAGACGTCGATACACGGGCTTACTTCACATCAGCTACCATGATCATCGCCATCCCAACCGGAGTAAAAGTCTTTAGTTGGTTAGCAACACTCCACGGAGGCAACATCAAATGATCCCCCGCTATAATATGAGCCCTAGGCTTCATCTTCCTTTTTACGGTGGGAGGCCTAACCGGAATTGTTTTAGCTAACTCCTCCCTTGATATTGTTCTCCACGACACATATTACGTAGTAGCACATTTTCACTACGTACTGTCAATAGGAGCTGTATTCGCCATCATAGGAGGGTTTGTACATTGATTTCCCCTATTCTCAGGCTACACTCTTAATGATACATGAGCCAAAATCCACTTCGCAATCATATTTGTGGGCGTTAACATAACCTTCTTCCCACAACATTTCCTAGGGTTATCTGGCATACCACGACGATACTCCGATTACCCAGACGCATATACAATATGAAATACTATTTCATCTATAGGTTCATTTATTTCATTAACAGCAGTAATACTAATAATTTTTATTATCTGAGAAGCATTCGCATCCAAACGAGAAGTCTCAACTGTAGACCTAACCACAACGAATCTAGAGTGACTGAACGGATGTCCTCCACCTTACCACACATTTGAAGAACCTACATACGTTAACCTAAAATAA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pseudois schaeferi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
EN
Endangered
Red List Criteria
A2cd
Version
3.1
Year Assessed
2008
Assessor/s
Harris, R.B.
Reviewer/s
Harris, R. & Festa-Bianchet, M. (Caprinae Red List Authority)
Contributor/s
Wang Yu & Xiao Wen
Justification
Listed as Endangered because of a serious population decline, estimated to be more than 50% over the last three generations (approximately 21 years), due to over-hunting and habitat destruction and/or degradation.
History
- 1996Endangered
- 1994Endangered(Groombridge 1994)
Trusted
Trends
Population
Population
Population Trend
Hu (1998) believed there were approximately 7,000 individuals in the mid-1990s, although this seems difficult to square with the reports of only a few hundred by Wang et al. (2000). Local hunters report that the numbers of this species have fallen drastically; previously observed group size ranges of 10 to 36 have dropped to three to eight animals in recent years. Density estimates of only 0.5 to 1.0 sheep/km² also suggest low numbers (Wu et al., 1990; Wang and Wang 2003). Smith and Xie (2008) also repeated concerns of a drastic decline in numbers.
Population Trend
Decreasing
Trusted
Threats
Major Threats
Hunting is a major threat to these animals, and if effective protection measures are not adopted quickly, the taxon will disappear in the near future. Humans and/or their livestock are present throughout the range of this species. Over-hunting is a serious threat, as is habitat degradation (Wang et al. 2000).
Trusted
Management
Conservation Actions
Conservation Actions
There is no formal legislation for its protection in China because when the national protection list was established, this species was considered to be P. nayaur and placed in Class II (although Smith and Xie 2008 show it as listed under Class II). Since dwarf blue sheep was recognized as a separate species, a concerted effort has been made by scientists temporarily working in the area to educate local hunters. The species does receive protection from local people in Baiyu (Sichuan) because of their religious beliefs (Cai et al., 1990). Conservation measures proposed: l) Re-assess its taxonomic status. 2) If it proves to be a separate species, dwarf blue sheep should be raised to a Class I species in the national protection list. 3) Protected areas need to be established. Reserves at Batang, or in adjacent areas where the population is still relatively abundant, have been suggested (Wu et al., 1990). 4) At the same time, surveys are essential to determine status and total distribution throughout its suspected range.
In 1995, a prefectural reserve covering 142.4 km² (which was enlarged to about 300 km² in 2007) around Zhubalong was established for the protection of this species (Wang et al., 2000). However, many human activities such as mushroom gathering, livestock grazing, and illegal hunting continue to occur in the core zone and thus threaten the populations here (Wang et al., 2000).
In 1995, a prefectural reserve covering 142.4 km² (which was enlarged to about 300 km² in 2007) around Zhubalong was established for the protection of this species (Wang et al., 2000). However, many human activities such as mushroom gathering, livestock grazing, and illegal hunting continue to occur in the core zone and thus threaten the populations here (Wang et al., 2000).
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

