Articles on this page are available in 1 other language: Arabic (13) (learn more)

Overview

Distribution

Geographic Range

Camelus bactrianus occurs throughout Asia north of the Himalayan massif.

(Sanderson, 1961)

Biogeographic Regions: palearctic (Native )

  • Nowak, R. 1997. Walker's Mammals of the World. Baltimore, Maryland: The Johns Hopkins University Press. Accessed August 03, 2003 at http://www.press.jhu.edu/books/walkers_mammals_of_the_world/artiodactyla/artiodactyla.camelidae.camelus.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Mongolia, China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The most noticeable features of C. bactrianus are their two humps. At the hump, average height is 213 cm (7 feet). A thick, shaggy, dark brown to beige coat covers the camel during cold weather and is shed when the temperature rises. Longer hair hangs from the neck and gives the appearance of a beard. Bushy eyebrows, a double row of eyelashes, ears lined with hair and the ability to close nostrils and lips tightly serve as protection from harsh, blowing winds and sand. Their tough, even-toed feet help them to cross the rocky deserts of Asia and travel well through snow or sand.

(Crump, 1981; Boitani and Bartali, 1982; Vaughan, 1972)

Range mass: 450 to 500 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Bactrian camels inhabit arid regions. They are found along rivers in the Siberian steppe during winter but disperse into the desert when snows melt in spring. Temperatures range from -29 degrees Celsius in the winter to 38 degrees Celsius in the summer.

(Crump, 1981)

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Camels are herbivores. They are able to eat plants that are dry, prickly, salty, and/or bitter, but prefer any kind of vegetation. When other nutrient sources are not available, these camels may feed on bones, other animals' skin, or different kinds of flesh. In more extreme conditions, they may eat rope, sandals, and even tents. Their ability to feed on a wide range of foods allows them to live in areas with sparse vegetation.

With tough mouths that can withstand sharp objects such as thorns, the digestion process begins. The first time food is swallowed it is not fully chewed. The partly masticated food (called cud) goes into the stomach and later is brought back up for further chewing.

Camels can go for several days without water. When water is available, they drink only to replace what is missing from their body. This amount can vary from nothing to 114 liters. Drinking the whole 114 liters of water takes only ten minutes. The camel also has the ability to quench its thirst with salty or brackish water. In the winter months, plants alone provide water.

A common misconception is that the camel's humps are for water storage. In reality, the humps contain a large amount of fat and are use for nourishment when food is scarce. This feature gives the camel the capability to go many days without eating. Each hump can hold up to 36 kg of fat. The hump decreases in size and become flabby as its contents are metabolized. Depletion of the hump is directly linked to the time between eating and the amount of energy expended. Thus, the size of the hump serves as an indication of C. bactrian's health, food supply and general well-being.

(Crump, 1981; Vaughan, 1972; Morris, 1965; Rice, 1901; Sanderson, 1961; McSpadden, 1947)

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Bactrian camels may live up to 50 years.

Range lifespan

Status: captivity:
50 (high) years.

Average lifespan

Status: captivity:
35.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 35.4 years (captivity) Observations: It has been suggested that the potential longevity of camels is up to 50 years (Ronald Nowak 1999). Record longevity in captivity for domestic camels, however, is 35.4 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Dominant males defend groups of females from other males during breeding seasons.

Mating System: polygynous

Mating season occurs in the fall. Males during this time are often violent and may bite, spit, or attempt to sit on other male camels. The age of sexual maturity varies, but is usually reached at three to five years. Gestation lasts thirteen months, with most young being born from March through April. One or occasionally two calves are produced. Females can give birth to a new calf every other year. The baby calf is precocial, having the ability to stand at birth and walk only a few hours after. The young calf stays with its mother for three to five years, until it reaches sexual maturity. Wild camels sometimes breed with domesticated or feral camels as well.

(Crump, 1981; Boitani and Bartali, 1982; Morris, 1965; Sanderson, 1961)

Breeding interval: Female camels can reproduce once every two years.

Breeding season: Breeding occurs in the fall.

Range number of offspring: 1 to 2.

Average gestation period: 13 months.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 36000 g.

Average gestation period: 395 days.

Average number of offspring: 1.

Young bactrian camels are precocial, being able to stand and run soon after birth. They are nursed for about 1.5 years in the wild and are fully grown by 5 years of age.

Parental Investment: precocial ; female parental care

  • Nowak, R. 1997. Walker's Mammals of the World. Baltimore, Maryland: The Johns Hopkins University Press. Accessed August 03, 2003 at http://www.press.jhu.edu/books/walkers_mammals_of_the_world/artiodactyla/artiodactyla.camelidae.camelus.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Camelus bactrianus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA802-07|EF212037|Camelus bactrianus| ACTCGCTGATTATTCTCAACCAACCACAAAGATATTGGAACTCTCTACCTATTATTTGGAGCTTGGGCTGGAATAGTAGGAATAGGACTA---AGCTTATTAATTCGCGCTGAATTGGGACAGCCCGGGACGTTGCTTGGAGAC---GACCAAATCTATAACGTAGTTGTAACAGCTCATGCTTTCGTCATGATCTTCTTTATGGTAATGCCAATCATGATTGGAGGCTTCGGGAACTGACTGGTCCCCCTAATA---ATTGGAGCCCCGGATATGGCGTTCCCCCGCATGAATAATATGAGCTTCTGACTGCTGCCTCCCTCATTCTTGCTACTACTAGCATCATCTATAGTTGAAGCAGGAGCAGGTACAGGCTGAACCGTTTACCCTCCCCTAGCCGGAAACCTGGCACACGCAGGCGCCTCCGTCGATTTA---ACTATTTTCTCCCTGCATTTAGCGGGAGTATCTTCAATTCTAGGGGCTATTAACTTTATTACCACTATTATCAATATAAAACCACCTGCTATATCCCAATACCAAACCCCTCTATTTGTCTGATCCGTTCTAATCACTGCCGTTCTCTTACTACTCTCCCTTCCGGTACTGGCTGCC---GGAATCACAATACTATTAACAGATCGTAACCTAAATACGACTTTCTTTGATCCTGCAGGAGGAGGGGATCCCATCCTTTACCAACACCTATTTTGATTCTTCGGTCACCCAGAGGTTTACATCCTAATCTTACCTGGCTTTGGAATAATTTCTCACATTGTCACTTATTACTCTGGAAAAAAG---GAGCCCTTTGGTTATATGGGAATAGTCTGGGCTATAATGTCTATCGGCTTCCTAGGCTTCATTGTATGAGCCCACCATATATTTACAGTAGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Camelus bactrianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Species: 9
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Bactrian camels were thought to be extinct in the wild until an expedition found some wild C. bactrianus in the Gobi desert in 1957. These wild groups are in the severe danger of going extinct and little is known about them. The estimated number of wild camels ranges from 400 to 700 animals in Mongolia and 200 in China. Compared to domestic camels, wild camels have smaller humps, smaller feet, shorter hair and a more slender body shape.

(Crump, 1981; Boitani and Bartali, 1982; Boorer, 1971; Morris, 1965)

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Camelus bactrianus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Camels can have ill effects on humans. When very hungry, camels may eat people's possessions such as tents, sandals or blankets.

(Crump, 1981)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Close to 3,500 years ago people first tamed wild camels and domesticated them; now almost all are domestic. The original purpose of domestication was probably to use their size and strength. Camels carry packages long distances to market and are used as a form of transportation. By the age of one year, the camel can take voice cammands from their owner. Humans also use many of the camel's by-products, especially camel meat and milk. Fat from the humps is melted down and serves in cooking. Dung provides fuel for heating. Loose hair is used for making clothes, blankets, carpets, and tents. The tanned hide is used to make shoes, sandals, and other leather products. In some countries, camels are an indication of wealth.

(Crump, 1981; Rice, 1901)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bactrian camel

The Bactrian camel (Camelus bactrianus) is a large, even-toed ungulate native to the steppes of central Asia. It is presently restricted in the wild to remote regions of the Gobi and Taklamakan Deserts of Mongolia and Xinjiang. A small number of wild Bactrian camels still roam the Mangystau Province of southwest Kazakhstan and Nubra Valley in India, and now run wild in Australia. It is one of the two surviving species of camel.[2] The Bactrian camel has two humps on its back, in contrast to the single-humped dromedary camel.[3]

Bactrian camels belong to a fairly small group of animals that regularly eat snow to provide their water needs. Any animals living above the snowline are obliged to do this as snow and ice are the only forms of water during winter, and by doing so their range is greatly enlarged. The latent heat of snow and ice is enormous compared with the heat capacity of water, demanding a large sacrifice in heat energy and forcing animals to eat only small amounts at a time. [4]

Nearly all of the 2 million camels alive today are domesticated.[5] In October 2002, the estimated 800 remaining in the wild in northwest China and Mongolia were classified as critically endangered on the IUCN Red List of Threatened Species.[1]

Some authorities, notably the IUCN, use the binomial name Camelus ferus for the wild Bactrian camel and reserve Camelus bactrianus for the domesticated form.[1]

Contents

History

Front and side of Bactrian camel head

The Bactrian camel is thought to have been domesticated (independently of the dromedary) sometime before 2500 BCE,[6] probably in northern Iran, Northeast Afghanistan,[6] or southwestern Turkestan.[7] The dromedary camel is believed to have been domesticated between 4000 BCE and 2000 BCE[8] in Arabia. The wild population of Bactrian camels was first described by Nikolai Przhevalsky in the late 19th century. Their name comes from the ancient historical region of Bactria.

Bactrian camels have been the focus of artwork throughout history. For example, western foreigners from the Tarim Basin and elsewhere were depicted in numerous ceramic figurines of the Chinese Tang dynasty (618–907).

Evolutionary history

As of the 1980s, a complete range of fossils suggests the first camelids appeared in North America about 30 million years ago, had a relatively small body mass and were adapted to warm climates.[9] By the early Pleistocene (about 2 million years ago), they had already evolved into a form similar to the current Bactrian camel, and many individuals permanently migrated to the opposite end of the Bering Strait in an abrupt fashion, probably as a response to the advancing ice age. The remaining related types of American camelids are now only in South America.

Subspecies

Bactrian camels in Nubra Valley, India

There is some evidence that the Bactrian camel can be divided into different subspecies. In particular, it has been discovered that a population of wild Bactrian camel lives within a part of the Gashun Gobi region of the Gobi Desert. This population is distinct from domesticated herds both in genetic makeup[10] and in behavior.[citation needed]

As many as three regions in the genetic makeup are distinctly different from domesticated camels, with up to a 3% difference in the base genetic code. However, with so few wild camels, it is unclear what the natural genetic diversity within a population would have been.[citation needed]

Another difference is the ability of these wild camels to drink saltwater slush, although it is not yet certain the camel can extract useful water from it. Domesticated camels do not attempt to drink salt water, though the reason is unknown.[citation needed]

Conservation

The Bactrian camel was identified as one of the top ten "focal species" in 2007 by the Evolutionarily Distinct and Globally Endangered (EDGE) project, which prioritises unique and threatened species for conservation.[11] Fewer than a thousand are thought to survive in the wild and the population is decreasing. The primary predators of wild Bactrian camels are wolves, which hunt around oases for easy prey.[12] A small captive population is kept in Mongolia and China.

Documentaries

  • The Story of the Weeping Camel is a 2003 Mongolian documentary/story about a family of nomadic shepherds trying to get a white colt accepted by his mother, who rejected him after a difficult birth.
  • Planet Earth: "Deserts" shows footage of wild camels from a two-month trek in the Gobi desert. It includes a "diary" section, explaining the difficulties in obtaining the footage.

See also

Gallery

References

  1. ^ a b c Hare, J. (2008). Camelus ferus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 31 January 2008. Database entry includes justification for why this species is critically endangered
  2. ^ Grubb, Peter (16 November 2005). "Order Artiodactyla (pp. 637-722)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 645. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200112. 
  3. ^ The mnemonic that allows you to remember the correct English word for each is this: "Bactrian" begins with "B", and "Dromedary" begins with "D" -- and "B" on its side has two humps, whilst "D" on its side has only one hump.
  4. ^ Replacing Water with Snow
  5. ^ "Bactrian Camel." EdgeofExistence.org. EDGE, 2010. Web. Accessed 11 Dec. 2011. [1]
  6. ^ a b "camel", Encyclopædia Britannica. 2007. Encyclopædia Britannica Online. accessed 11 February 2007.
  7. ^ Myths About Camels, The Hatch Report.com.
  8. ^ Al-Swailem, et al. Classification of Saudi Arabian camel (Camelus dromedarius) subtypes based on RAPD technique., Journal of Food, Agriculture and Environment, Vol.5 (1) : 143-148. 2007.
  9. ^ Ferguson, K. "Agricultural Landscape: Invented Tradition of the Mesa Verde World". Cortez: University of Cortez, in press).
  10. ^ "Wild camels 'genetically unique'". Earth News (BBC). 11:09 GMT, Wednesday, 22 July 2009. http://news.bbc.co.uk/earth/hi/earth_news/newsid_8151000/8151804.stm. Retrieved 22 July 2009. 
  11. ^ "Protection for 'weirdest' species". BBC. 2007-01-16. http://news.bbc.co.uk/2/hi/science/nature/6263331.stm. Retrieved 2007-05-22. 
  12. ^ Kara Rogers. The Last Wild Camels. Encyclopedia Britannica Blog. (Posted: February 18, 2010)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!