Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Native range extends from the Mississippi-Ohio confluence down the Mississippi River floodplain to Louisiana, and along the Gulf coastal Plain southwest to Alabama, to the Rio Grande basin in south New Mexico and north Mexico. Mexican distribution includes Baja California, Baja California Sur, Chihuahua, Sonora, Sinaloa, Durango, Coahuila, Nuevo Leon, and Tamaulipas (Hernandez et al., 2008). It was widely introduced in many places throughout Africa, Asia, and Europe, and also outside its native range in North America. (See Hobbs, 1989). Genetic variation in introduced European populations found to be high enough to uniquely fingerprint most of the surveyed individuals (Barbaresi et al., 2003) and a similar situation exists in Asia (Yue et al., 2010). In the United States, established non-native populations now occur in California, Nevada, Idaho, Illinois, New York, North Carolina, Ohio, Oregon, and Washington (Taylor and Schuster, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is wide-ranging from northern Mexico, to Escambia County in Florida, North to southern Illinois and Ohio. It has been widely introduced in the United States and elsewhere; Huner (1986) recorded the following introductions: Arizona, California, Georgia, Hawaii, Idaho, Indiana, Maryland, North Carolina, Nevada, Ohio, Oregon, South Carolina, Utah and Virginia. This species has also been introduced to Europe, Africa, East Asia, South and Central America (K. Crandall pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Although crayfish inhabitat many regions of the Earth, members of the genus Procambarus are located in North America. Procambarus clarkii are mostly found south-central United States, and northeastern Mexico (areas to which this species is native). The red swamp crayfish has also been transplanted to Hawaii, Japan, and even the River Nile (Safra, et al 1999; Jarmon 1999).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Europe

Introduced to southern Spain in 1973, this crayfish became an important commercial species inside 10 years, and it is now the most abundant and widespread crayfish species in Spain. It is now also abundant in France, Italy and on several Mediterranean islands, and extends as far north as the U.K. and Germany.

  • Souty-Grosset, C., Holdich, D.M., Noel, P.Y., Reynolds, J.D. and Haffner, P. (eds) 2006. Atlas of crayfish in Europe. Museum national d'Histoire naturelle, Paris. 187 pages. Patrimoines naturels, 64
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Julian Reynolds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults of this species are about 2.2 to 4.7 inches in length. Crayfish are characterized by a joined head and thorax, and a segmented body. In the case of the species Procambarus clarkii, the body is a very dark red color, with a wedge-shaped black stripe on the abdomen. Crayfish have a sharp snout and moveable eyes on their heads. Like all arthropods, crayfish have a thin but tough exoskeleton that they shed during development. Crayfish have 5 pairs of walking legs, the first of which are large pinchers used for feeding. On the red swamp crayfish, the pinchers tend to be narrow and long. They have long antennae with sensory organs on them. This along with appendages used for feeding, are characteristic of the subphylum Mandibulata. There are also five pairs of smaller appendages called swimmerets on the abdomen. The carapace of this species, located on the dorsal side, are not separated by a space. The most posterior pair of appendages are called uropods. Uropods are flat, broad extentions that surround the telson, which is the last abdominal segment. Uropods are also used for swimming (Safra, et al 1999; McDonald 1996; Vodopich and Moore 1999; Barnes 1974).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Male with hooks on ischia of 3rd & 4th pereiopods; male first pleopod with lobate cephgalic process sharply angled on caudodiostal margin and sharp angular shoulder on cephalic margin proximal to terminal elements; areola narrow to obliterated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: In Missouri, it occurs more often in flowing water habitats than the white river crayfish (61% lowland streams and ditches, 79% of these with noticeable current or flow), but also in swamps, sloughs and roadside pools; bottom usually mud or sand, often where there were considerable quantities of organic debris such as logs, sticks or water-soaked tree leaves (Pflieger, 1996). It is very tolerant of low oxygen and high temperature; is a secondary burrower; and is found in almost every type habitat in sluggish streams and lentic situations. It is one of few North American crayfishes with salinity tolerance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in a range of habitat types including wet meadows, subterranean karst systems, seasonal swamps and marsh, permanent lakes and streams, rice paddy fields, and irrigation channels and reservoirs (Global Invasive Species Database 2009). This species is able to tolerate a range of environmental conditions including low oxygen levels and high temperatures (Global Invasive Species Database 2009).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As the common name implies, red swamp crayfish are found mainly in swamps, sloughs, and ditches. This species avoids streams and areas with strong current. During periods of drought or cold, the red swamp crayfish burrows itself for survival (McDonald 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Reports of migrations of males of several miles over comparatively dry areas, esp. in fall rainy season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic; thrives on various commercial "pet foods".

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Although some crayfish are known to feed on vegetation, the red swamp crayfish is carnivorous, eating insect larvae, tadpoles, and snails. When traditional food sources are scarce, the crayfish eat the remains of dead animals and worms as well (Safra, et al 1999; Barnes 1974).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Procambarus clarkii preys on:
detritus

Based on studies in:
USA: Hawaii (Swamp)

This list may not be complete but is based on published studies.
  • G. E. Walsh, An ecological study of a Hawaiian mangrove swamp. In: Estuaries, G. H. Lauff, Ed. (American Association for the Advancement of Science Publication 83, Washington, DC, 1967), pp. 420-431, from p. 424, from p. 424.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: The species has been introduced to Massachusetts (University of Massachusetts campus pond, Amherst) and Rhode Island (University of Rhode Island campus pond, Kingston) (Smith, 2000). Recently it was found at a single in the Catawba River in North Carolina (Alderman, 2005). It has been introduced to all North Carolina river basins in the Piedmont Plateau and Coastal Plain (Cooper and Armstrong, 2007; Simmons and Fraley, 2010). It has been introduced in a variety of aquatic habitats in lentic areas in South Carolina across much of the state (Eversole and Jones, 2004).In Georgia, it has been introduced into a single stream in downtown Athens and a highly disturbed urban stream in Gwinnett Co. and an urban stream in the Etowah River system (Skelton, 2010). In the Cumberland Plateau it occurs from introductions in the Black Warrior River system in Jefferson Co., Alabama. (Bouchard, 1974). In Kentucky, it has a distribution almost identical to Procambarus viaeviridis; known from the floodplains of the extreme lower Tennessee, lower Ohio, and Mississippi Rivers and from tributaries of the Mississippi River in the extreme western portion of the state (Taylor and Schuster, 2004). In Indiana, it was collected in 2000 from Lake Michigan in Indiana and it has spread into the West Branch of the Grand Calamet River (Simon, 2001) and more recently in East Branch Calumet River in Lake Co. (Simon et al., 2005). In Ohio, it was introduced in the western end of Sandusky Bay, a fish hatchery at Denison University, and the Grand River upstream of Harpersfield Dam (Thoma and Jezerinac, 2000). In Missouri, it occurs widely in the Lowland Faunal Region (Pflieger, 1996). In Illinois it is known from lowland habitats in the extreme southern Illinois counties of Alexander, Jackson, massac, Pope, Pulaski, and Union (Page, 1985) and recently the North branch Chicago River in Chicago, Cook Co.; hundreds of km north (Taylor and Tucker, 2005). In Alabama, it is known from the Tennessee, Mobile, Black Warrior, Cahaba, Coosa, Tallapoosa, and Escambia River systems (Schuster and Taylor, 2004) as well as Alabama, Pascagoula, and Tombigbee drainages (Schuster et al., 2008). In Texas, the natural range is throughout the eastern portion along the coastal plain and upstream within rivers thatr flow from the Edwards Plateau into the Gulf (Johnson and Johnson, 2008). This species has been documented in Cuatro Cienegas, Coahuila, Mexico (Dinger et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Circadian as melatonin induces changes in excitability of photoreceptors in the eyestalks of this species (Solorzano-Garcia et al., 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Year round breeder, intrapopulational variation of seasonality high & single female may produce >1 brood in a year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The red swamp crayfish mate in late autumn. Sexes are separate, but the location of gonads are similar in both males and females -just anterior to the heart. Testes are usually white, while ovaries are usually orange. The sperm cells (crayfish sperm lack tails and are sometimes referred to as spermatophores) are released from the body of male crayfish through a pore at the base of the fifth pair of walking legs. Fertilization is internal. Sperm enters the female at the base of the third pair of walking legs, where the eggs are fertilized and released. The female crayfish then lies on her back and curls her abdomen forward. By beating her pleopods, or swimmerets, the female creates a water current which drives the fertilized eggs into the swimmerets where they will remain for approximately 6 weeks. By spring, the eggs will become larvae, and remain on the mother until sexually mature. The red swamp crayfish reach maturity in as little as three months, and in warm climates can reproduce two generations per year. Large healthy females typically produce over 600 viable young (Barnes 1974; Vodopich and Moore 1999; Safra, et al 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Procambarus clarkii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Procambarus clarkii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGATGATTTTTTTCTACAAATCATAAGGATATTGGAACATTATATTTTGTTTTTGGTACTTGAGCTGGTATAGTAGGAACTTCATTAAGAATGATTATTCGGGTGGAGTTAGGTCAACCAGGAAGATTAATTGGGGATGATCAGATCTATAATGTGGTAGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGTGCTCCAGATATGGCTTTTCCTCGAATAAATAATATAAGGTTTTGATTACTTCCTTTTTCGTTGACTTTATTATTAACTAGGGGTATAGTTGAGAGAGGAGTTGGAACAGGATGGACTGTTTACCCTCCTTTAGCTTCTGCTATTGCTCATGCGGGAGCATCTGTAGATTTAGGTATTTTTTCTCTACATTTAGCAGGTGTATCTTCTATTTTAGGTTCAGTAAATTTTATAACAACTGCTATTAATATACGAACAGTAGGGATAACCATGGATCGAATACCGTTATTTGTTTGATCAGTGTTTATTACTACTGTTTTATTATTATTATCTTTACCTGTGTTGGCAGGAGCTATTACTATATTATTAACAGATCGTAATCTAAATACTTCTTTTTTTGATCCAGCAGGAGGAGGGGATCCTATTTTATATCAGCATTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTTTAATTTTACCTGCTTTTGGTATAGTATCTCATATTGTAGTTCAAGAATCAGGTAAGAAAGAGGCTTTTGGGACATTAGGTATAATTTATGCTATAATTGCTATTGGTATTTTAGGTTTTGTAGTATGAGCTCATCATATATTTACGGTAGGGATGGATGTAGATACTCGGGCTTATTTTACTTCTGCTACGATAATTATTGCGGTTCCTACTGGTATTAAAATTTTTAGTTGATTAGGAACTCTTCAGGGAACGCAAGTAAATTACAGTCCTTCTTTATTATGGGTATTAGGCTTTATTTTTTTATTTACTGTAGGGGGGTTAACTGGGGTTGTGTTAGCTAATTCTTCTATTGATATTATTCTTCATGACACTTATTATGTAGTGGCTCATTTTCATTATGTTTTATCCATAGGGGCTGTGTTTGGAATTTTTGCAGGTATTGTTCATTGATTCCCTTTGTTTACCGGTTTATCTTTAAATCAAAAATGATTAAAAATTCATTTTTTTACTATATTTGTGGGGGTAAATGTAACATTTTTTCCTCAACATTTTTTAGGTTTAAATGGGATACCTCGACGTTATTCAGATTATCCCGATGCTTATAGGGCATGAAATGTTTTATCTTCAATTGGTTCTATTATTTCTTTGGTAGCTGTGTTAGGATTTGTAATTATTGTTTGAGAGGCTTTTATTATAAGTCGAAAAAGATTTAGATCTCTTTTTATACCTACTTCTATAGAATGACAGCATTCTTATCCTCCTGCTGATCATACTTATTCTGAGATTCCATTAATTTCTAATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Native range extends from the Mississippi-Ohio confluence down the Mississippi River floodplain to Louisiana, and along the Gulf coastal Plain southwest to Alabama, to the Rio Grande basin in south New Mexico and north Mexico. It was widely introduced in many places throughout Africa, Asia, and Europe, and also outside its native range in North America.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: It is an extreme generalist and colonizer. Hypoxia found to reduce survival by 31% and growth by 16% after 12 weeks, and survival by 65% and growth by 90% after 6 weeks (McClain, 1999). Able to survive extensive periods of burrowing, including periods of air exposure, by recovering haemolymph levels rapidly following oxygen depravation and rapid excretion in burrows (McMahon and Stuart, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Crandall, K.A.

Reviewer/s
Collen, B. & Richman, N.

Contributor/s
Livingston, F., Soulsby, A.-M., Batchelor, A., Dyer, E., Whitton, F., Milligan, H.T., Smith, J., Lutz, M.L., De Silva, R., McGuinness, S., Kasthala, G., Jopling, B., Sullivan, K. & Cryer, G.

Justification
Procambarus clarkii has been assessed as Least Concern. This species is abundant and able to tolerate a range of habitat types within its natural range. It is under no imminent threat. Further research is required to determine the abundance of this species, and whether it is being impacted upon by any major threat processes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procambarus clarkii is a large prolific species of crayfish. Characterized by its aggressive burrowing, this speices is well adapted to life even when water levels fluctuate drastically. It is not surprising, that this species survives in very simple, shallow burrows (Jarmon 1999).

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Global Long Term Trend: Increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
"The population at the Granville County site is extremely large, both in numbers and biomass. There is a very dense population distributed throughout the small ponds along Ledge Creek and in shallow areas of the creek itself" (Cooper et al. 1998). This is typical of this species in its native range (K. Crandall pers. comm. 2009).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: The red swamp crayfish is a highly invasive species which is under no threat. It is a major threat to other crayfish and to freshwater ecosystems in general. In an anomalous instance, P. acutus replaced P. clarkii in experimental culture ponds in South Carolina in <10 years (Eversole et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is highly invasive, and is not impacted upon by any threats (K. Crandall pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation measures in place for this species. This species has been given a NatureServe Global Heritage Status Rank of G5, and was assigned an American Fisheries Society Status of Currently Stable (Taylor et al. 2007, NatureServe 2009). Further research is required to determine the abundance of this species, and whether it is being impacted upon by any major threat processes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Most significant aquaculture crayfish in the world and very significant fishery in LA. Hypoxia found to reduce survival by 31% and growth by 16% after 12 weeks, and survival by 65% and growth by 90% after 6 weeks (McClain, 1999). Able to survive extensive periods of burrowing, including periods of air exposure, by recovering haemolymph levels rapidly following oxygen depravation and rapid excretion in burrows (McMahon and Stuart, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Because of the success of commercial aquaculture in its native southern USA, the red swamp crayfish has been introduced to many other areas. Most of these introductions have had negative consequences. Many of these areas have sophisticated irrigation systems in which the crayfish have burrowed. The burrowing activity has damaged the levees, dams, and water control structures. In addition, Procambarus clarkii is an intermediate host for many parasitic helminths of vertebrates, which may create new health problems in areas where the species is successfully established. Because of such adverse effects, many areas introduced to the red swamp crayfish are now trying to eradicate them (Jarmon 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The red swamp crayfish, along with many other species of crayfish are an important source of food for humans. Especially in areas where Cajun communities are common, crayfish are the main ingredient in many everyday meals. Louisiana alone has 48,500+ ha of culture ponds. Procambarus clarkii was introduced to Japan as a food source for bullfrogs, and is now a common family pet all over the main island. This species also appears in many European pet markets. This species is very selective when it comes to its diet. There are many aquatic and semi-aquatic snails that are vectors for human pathogens such as Schistosomiasis. The red swamp crayfish significantly contribute to the control of these snail populations (Barnes 1974; Jarmon 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Procambarus clarkii

Procambarus clarkii is a freshwater crayfish species, native to the Southeastern United States, but found also on other continents, where it is often an invasive pest. It is known variously as the red swamp crawfish, red swamp crayfish, Louisiana crawfish, Louisiana crayfish or mudbug.[3]

Range and range expansion[edit]

The native range of P. clarkii is along the Gulf Coast from northern Mexico to the Florida panhandle, as well as inland, to southern Illinois and Ohio.[1] It has also been introduced, sometimes deliberately, outside its natural range to countries in Asia, Africa, Europe and elsewhere in the Americas. In northern Europe, the populations are self maintaining but not expanding, while in southern Europe, P. clarkii is multiplying and actively colonising new territory, at the expense of the native crayfish, Astacus astacus and Austropotamobius spp.. Individuals are reported to be able to cross many miles of relatively dry ground, especially in wet seasons, although the aquarium trade and anglers may have hastened the spread in some areas (it is believed that anglers using P. clarkii as bait introduced it to the American state of Washington). Attempts have also been made to use P. clarkii as a biological control organism, to reduce levels of the snails involved in the life cycle of schistosomiasis, leading to the dispersal of P. clarkii in, for instance, Kenya.

Ecology[edit]

P. clarkii, dorsal view

P. clarkii is most commonly found in warm fresh water, such as slowly flowing rivers, marshes, reservoirs, irrigation systems and rice paddies. It is considered to be the most ecologically plastic species in the order Decapoda, and is able to grow quickly even in only seasonally present water, being able to tolerate dry spells of up to four months. P. clarkii grows quickly, and is capable of reaching weights in excess of 50 g, and sizes of 5.5–12 cm (2.2–4.7 in) long.[4] It is also able to tolerate slightly saline water, which is unusual for a crayfish. Additionally, P. clarkii are physiologically capable of tolerating relatively low dissolved oxygen concentrations.[5] The average lifetime of Procambarus clarkii is five years. Some individuals are known to have reached ages (in nature) of over six years.

The burrowing activities of P. clarkii can lead to damage to water courses and to crops, particularly rice, and its feeding can disrupt native ecosystems. It may out-compete the native crayfish species, and is a vector for the crayfish plague fungus Aphanomyces astaci, for crayfish virus vibriosis, and a number of worms parasitic on vertebrates.

Economic importance[edit]

Harvests of P. clarkii account for a large majority of the crayfish produced in the United States and elsewhere. Crayfish farming began in Louisiana in the 18th century, taking place in rice fields in a concurrent or alternate culture system. The concurrent culture of rice and crayfish makes good use of land, resources, equipment, and infrastructure already being used for rice production. However, crawfish production has decreased in recent years due to an increase of imports from China, which is now the world's leading producer of crawfish and is also using a rice-based system.[6] A number of species of crustaceans were introduced to China to create markets for aquaculture and because they are better adapted to growing in a rice field than native fish species. Rice-fish farming originated in China and is once again growing as the yields from Green Revolution practices used to grow rice are no longer increasing and resources, such as land and water, are becoming more limited.[7]

P. clarkii has also been introduced elsewhere for cultivation, such as Spain, where its success is attributable to its ability to colonise disturbed habitats that would be unsuitable for the native crayfish. P. clarkii is also marketed by biological supply companies for teaching and research. P. clarkii also exhibits different color morphs, including white, blue, and orange and are commonly sold in pet stores.

The introduction of P. clarkii has also resulted in economic losses in some regions. In the Baixo Mondego region of Portugal, it caused a decrease in 6.3% of profits in rice fields.[8] However, this was on a wet-seeded field. All negative effects of crawfish can be avoided if adult crawfish are separated from the seed and seedlings.[9]

As food[edit]

Boiled crawfish, Louisiana

Procambarus clarkii is eaten in United States, Cambodia, Europe, China, Africa, Australia, Canada, New Zealand and the Caribbean. About 98% of the crayfish harvested in the United States come from Louisiana, where the standard culinary term is crawfish.

Louisiana in 1990 produced 90% of the crawfish in the world and consumed 70% locally.[10]

Louisiana crawfish are usually boiled in a large pot with heavy seasoning (salt, cayenne pepper, lemon, garlic, bay leaves, etc.) and other items such as potatoes and corn on the cob. Many differing methods are used to season a crawfish boil, and an equal number of opinions on which one is correct.[11] They are generally served at a gathering known as a crawfish boil.

Reproduction[edit]

Procambarus clarkii normally reproduces sexually, but recent research suggests it may also reproduce by parthenogenesis.[12]

References[edit]

  1. ^ a b K. A. Crandall (2010). "Procambarus clarkii". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved April 13, 2011. 
  2. ^ C. Girard (1852). "A revision of the North American astaci, with observations on their habits and geographic distribution". Proceedings of the Academy of Natural Sciences of Philadelphia 6: 87–91. 
  3. ^ "Seafood List Search Returns". FDA Acceptable Seafood Name Database. 2008. Retrieved July 17, 2010. 
  4. ^ "Procambarus clarkii (crustacean)". Global Invasive Species Database. March 31, 2006. Retrieved January 31, 2010. 
  5. ^ Bonvillain, Christopher P.; D. Allen Rutherford, William E. Kelso, and Christopher C. Green (2012). "Physiological biomarkers of hypoxic stress in red swamp crayfish Procambarus clarkii from field and laboratory experiments". Comparative Biochemistry and Physiology A 163: 15–21. doi:10.1016/j.cbpa.2012.04.015. 
  6. ^ W. Ray McClain & Robert P. Romaire. "Crawfish culture: A Louisiana aquaculture success story" (PDF). World Aquaculture 35 (4): 31–35, 60–61. 
  7. ^ Miao Weimin (2010). "Recent developments in rice-fish culture in China: a holistic approach for livelihood improvement in rural areas". Success Stories in Asian Aquaculture. pp. 15–40. doi:10.1007/978-90-481-3087-0_2. ISBN 978-90-481-3087-0. 
  8. ^ Pedto M. Anastácio, Vasco S. Parente & Alexandra M. Correia (2005). "Crayfish effects on seeds and seedlings: identification and quantification of damage". Freshwater Biology 50 (4): 697–704. doi:10.1111/j.1365-2427.2005.01343.x. 
  9. ^ https://estudogeral.sib.uc.pt/jspui/bitstream/10316/5448/1/file50b1ec0e12ad4323b6772dcd484668a8.pdf
  10. ^ Larry W. de la Bretonne, Jr. and Robert P. Romaire (1990). "Crawfish production: harvesting, marketing and economics" (PDF). SRAC Publication (Southern Regional Aquaculture Center) 42. 
  11. ^ How to Season a Crawfish Boil
  12. ^ G. H. Yue, G. L. Wang, B. Q. Zhu, C. M. Wang, Z .Y. Zhu, L. C. Lo (2008). "Discovery of four natural clones in a crayfish species Procambarus clarkii". International Journal of Biological Sciences 4 (5): 279–282. doi:10.7150/ijbs.4.279. PMC 2532795. PMID 18781225. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Electrophoretic phylogenetic analysis revealed the five southeastern species of teh subgenus Scapulicambarus revealed two cl;ades, one containing P. clarkii and P. troglodytes, and the other containing P. howellae, P. paeninsulanus, and P. okaloosae (Busack, 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!