Overview

Comprehensive Description

Description

 Pandalus montagui is a semi-transparent, pink colour shrimp. Generally 40-50 mm in length although may be much longer. Rostrum long, curves markedly upwards, tip divided in two.Individuals mature and breed in the first year of life. In the North Sea eggs are laid from November to February and hatch in April/May. Pandalus montagui feeds mainly on hydroids, small crustaceans and polychaetes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Europe, Baltic sea, Belgian Exclusive Economic Zone, British Isles, Canadian part of the Arctic Ocean, Cobscook Bay, Davis Strait, Dutch Exclusive Economic Zone, England, English Channel, European waters (ERMS scope), Faeroes, FAO fishing area 18, FAO fishing area 21, Grevelingen, Gulf of Maine, Gulf of St. Lawrence, Hudson Strait, Icelandic Exclusive Economic Zone, Irish Exclusive economic Zone, Manicouagan, North Sea, North West Atlantic, Norwegian Exclusive Economic Zone, Oostende, Oosterschelde, Saguenay Fjord, Saint Lawrence River, St. Lawrence Estuary, Swedish Exclusive Economic Zone, United Kingdom, United Kingdom Exclusive Economic Zone, West Atlantic, Western Channel, Westerschelde, Wimereux, Zeebrugge
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Greenland to Rhode Island, including Cobscook Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4249 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2181 samples.

Environmental ranges
  Depth range (m): 0 - 958.5
  Temperature range (°C): -0.962 - 13.325
  Nitrate (umol/L): 1.402 - 32.233
  Salinity (PPS): 27.525 - 35.364
  Oxygen (ml/l): 2.935 - 7.862
  Phosphate (umol/l): 0.091 - 2.511
  Silicate (umol/l): 0.987 - 46.650

Graphical representation

Depth range (m): 0 - 958.5

Temperature range (°C): -0.962 - 13.325

Nitrate (umol/L): 1.402 - 32.233

Salinity (PPS): 27.525 - 35.364

Oxygen (ml/l): 2.935 - 7.862

Phosphate (umol/l): 0.091 - 2.511

Silicate (umol/l): 0.987 - 46.650
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 It extends to depths of 100 m or more, but it is occasionally found in rock pools on the lower shore. Offshore migration takes place in most areas in October/November, followed by a migration into shallow water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus montagui

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATCTTTGGAGCTTGGTCTGGAATAGTAGGGACTTCTTTAAGACTTTTAATTCGAGCTGAACTTGGTCAACCAGGTAGATTGGTCGGAAATGATCAAATCTATAATGTTGTAGTCACAGCTCATGCTTTTGTTATAATTTTTTTTATGGTAATACCAATTATAATTGGTGGTTTTGGAAACTGGCTTGTACCATTAATATTAGGTGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGGCTCTTGCCCCCCTCCCTCACACTTCTTCTCTCCAGTGGAATAGTGGAAAGCGGGGTTGGCACCGGTTGAACAGTTTACCCCCCACTGTCGGCGGGGATTGCCCACGCCGGGGCTTCAGTGGATCTTGGGATTTTTTCTCTTCACTTAGCCGGAGTGTCTTCTATCTTAGGAGCCGTTAATTTTATAACTACAGTTATTAATATACGAAGAATAGGAATATCTATAGACCGAATGCCTCTTTTTGTTTGATCTGTTTTTTTAACTGCTCTTTTACTACTCCTATCACTACCAGTTCTTGCTGGAGCAATTACAATATTATTAACAGACCGAAACCTAAATACCTCCTTCTTTGACCCCGCAGGCGGCGGAGACCCTATTTTATACCAACACTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus montagui

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pandalus montagui

Pandalus montagui is a species of cold-water shrimp in the family Pandalidae. It is the type species of the genus Pandalus and is variously known as the pink shrimp, Aesop shrimp and Aesop prawn.[2]

Contents

Description

Pandalus montagui is a translucent, pinkish shrimp, generally growing to about 5 centimetres (2.0 in) long. The colour is due to a number of red chromatophores and there are also a few short red streaks running obliquely on the carapace. The rostrum is long, up-curved and divided at the tip with 10–12 teeth on its posterior dorsal edge. There is a spine under the eye on the carapace. The first antenna divides into two parts and the second is very long, exceeding the length of the body and being banded in pale and dark brown.[3][4] This shrimp can be distinguished from the rather similar Pandalus tridens by having a shorter rostrum and longer dactyls (claws) on the third and fourth pereopods (walking limbs).[5]

Distribution and habitat

Pandalus montagui has a boreo-arctic distribution. Its range extends from Greenland and Iceland, the Arctic Ocean and northern Atlantic Ocean, south to Rhode Island and the British Isles.[5] It prefers hard substrates but can be found on rock, gravel, sand and mud. It is most common at depths between 20 metres (66 ft) and 100 m (330 ft) but sometimes occurs near low water mark or at depths down to 700 m (2,300 ft).[2]

Biology

Pandalus montagui is an omnivore, predator and scavenger.[1] The diet consists mainly of small crustaceans such as copepods, hydroids and polychaete worms.[3] Off the Labrador coast there was found to be a large daily vertical migration with the shrimp being benthic in the daytime and pelagic at night.[6]

Most individuals start life as males but change sex to females at 12–15 months. In the North Sea, off Britain, each female lays 2000–3000 eggs in November. When fertilised, she carries these around for a few days on her pereopods. They then hatch and go through 6 zoeal and 2–5 decapod planktonic larval stages before undergoing metamorphosis and settling as juveniles. The rate of development of the larvae depends on the water temperature. In the more temperate parts of the range the shrimps mature within a year.[7]

Ecology

In the North Sea, Pandalus montagui is often found living in association with the polychaete worm Sabellaria spinulosa. The worm sometimes forms cold water reefs and these are an important source of food for the shrimp. Fisherman have used this fact by identifying the locations of reefs and then trawling for shrimps nearby.[8]

Pandalus montagui is sometimes found to be parasitized by the bopyrid isopod, Hemiarthrus abdominalis. This isopod also parasitizes several other species of shrimp but has never been found on Pandalus borealis.[9]

Fishery

Pandalus montagui is fished commercially in the United Kingdom but mostly taken as an alternative to the larger shrimp, Pandalus borealis. About 500 tons a year of Pandalus montagui were caught globally in the period 2005–2007, catches also being recorded from Belgium, Denmark the Faröe Islands, the Netherlands, Iceland, Norway and Sweden.[2]

References

  1. ^ a b Charles Fransen, Sammy De Grave & Michael Türkay (2011). "Pandalus montagui Leach, 1814 [in Leach, 1813-1814]". World Register of Marine Species. Retrieved December 9, 2011. 
  2. ^ a b c Pandalus montagui (Leach, 1814) FAO: Fisheries and Aquaculture Department. Retrieved 2011-11-04.
  3. ^ a b Pink shrimp – Pandalus montagui Marine Life Information Network. Retrieved 2011-11-04.
  4. ^ Pandalus montagui Marine Species Identification Portal. Retrieved 2011-11-04.
  5. ^ a b T. Komai (1999). "A revision of the genus Pandalus (Crustacea: Decapoda: Caridea: Pandalidae)" (PDF). Journal of Natural History 33 (9): 1265–1372. doi:10.1080/002229399299914. 
  6. ^ C. Hudon, D. G. Parsons & R. Crawford (1992). "Diel pelagic foraging by a pandalid shrimp (Pandalus montagui) off Resolution Island (Eastern Hudson Strait)". Canadian Journal of Fisheries and Aquatic Sciences 49 (3): 565–576. doi:10.1139/f92-066. 
  7. ^ Kirstin Schultze & K. Anger (1997). "Larval growth patterns in the Aesop shrimp, Pandalus montagui" (PDF). Journal of Crustacean Biology 17 (3): 472. JSTOR 1549441. 
  8. ^ P. J. Warren & R. W. Sheldon (1967). "Feeding and migration patterns of the pink shrimp Pandalus montagui, in the estuary of the River Crouch, Essex, England". Journal of the Fisheries Research Board of Canada 24 (3): 569–580. doi:10.1139/f67-049. 
  9. ^ J. A. Allen (1966). "Notes on the relationship of the Bopyrid parasite Hemiarthrus abdominalis (Krøyer) with its hosts". Crustaceana 10 (1): 1–6. JSTOR 20102710. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!