Overview

Comprehensive Description

Gammarus mucronatus is a highly motile shallow marine gammarid amphipod endemic to the coastal and estuarine waters of the US Atlantic coast. Individuals are typically light green to greenish-brown, with red to brown spots and subtle banding on antennae and appendages. The rounded head has a pair of large, reniform (kidney-shaped) eyes, typical of the genus. Three posterior body segments (pleosomes 1-3) usually possess sharp, posterioriorly-directed mucronations (points) that give the species it's name. The first pair of antennae are greater or equal to the second in length (Bousfield 1973). As with all gammaridean amphipods, the body is laterally compressed.The species is sexually dimorphic, with adult males being longer-bodied than females, and with the dactyl of the gnathopod (the anterior-most walking appendage) modified into a hook used to grasp females during precopulation and copulation.Bousfield (1973) provides a more detailed species description suitable for professional taxonomic purposes.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Gulf of St. Lawrence south to Florida and the Gulf states
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gammarus mucronatus occurs in coastal and estuarine environments along the US Atlantic coast from the Gulf of St. Lawrence south to Florida and the Gulf of Mexico (Bousfield 1969, 1973). Gammarus mucronatus is commonly encountered throughout the India River Lagoon.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

The field study by Fredette and Diaz (1986a) indicates that mean adult length in the study population ranged from around 1.1 mm to 3.7 mm. Individuals were capable of rapid growth, exhibiting average winter growth rates of 0.04 mm/day and spring growth rates of 0.11 mm/day.Bousfield (1973) indicates an annual life cycle for this species.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

A great number of epifaunal and/or phytal gammaridean amphipods co-occur with Gammarus mucronatus in throughout its range. In the Indian River Lagoon, the large reniform eye and the mucronate pleopods should be sufficient to allow amateur naturalists to distinguish G. mucronatus from other amphipod species.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal and infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 149 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): -99 - 39
  Temperature range (°C): 9.208 - 23.731
  Nitrate (umol/L): 0.327 - 3.829
  Salinity (PPS): 32.282 - 35.580
  Oxygen (ml/l): 4.845 - 6.764
  Phosphate (umol/l): 0.110 - 0.547
  Silicate (umol/l): 0.868 - 2.666

Graphical representation

Depth range (m): -99 - 39

Temperature range (°C): 9.208 - 23.731

Nitrate (umol/L): 0.327 - 3.829

Salinity (PPS): 32.282 - 35.580

Oxygen (ml/l): 4.845 - 6.764

Phosphate (umol/l): 0.110 - 0.547

Silicate (umol/l): 0.868 - 2.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Gammarus mucronatus is a generalist grazer whose diet includes microalgae and detritus, a limited amount of macroalgae, and possibly a small amount of macrofauna (Zimmerman et al 1979).Laboratory grazing studies by Hauxwell et al. (1998) using the chlorophyte alga Cladophora vagabunda as a food source revealed a G. mucronatus grazing rate ranging between 0.3 mg (low-nitrogen estuary conditions) and 0.8 mg (high-nitrogen estuary conditions) dry wt./individual/day. Howard (1982) indicates that seagrass-dwelling G. mucronatus are important both as grazers of seagrass epiphytes and as detritivores capable of mechanically reducing detrital particle size through the shredding action of its feeding appendages. Competitors: Experimental studies by Duffy et al. (2001) examining the functional redundancy of several seagrass-associated crustaceans species indicate a high degree of dietary niche overlap between Gammarus mucronatus and co-occurring species, indicating that a degree of trophic competition may exist. Predators: Gammarus mucronatus is a principle prey item for juvenile and adult fish of several species, and also for large decapods (Young et al. 1976). Fredette and Diaz (1986a) suggested that the spring and summer population decline of G. mucronatus in seagrass habitats is caused by the arrival of migratory predators in the spring and summer. Nelson (1979, 1980) cited fish predation, particularly juvenile pinfish (Lagodon rhomboids), as a key seasonal factor limiting Indian River Lagoon amphipod populations. Stoner (1980), however, noted that some seagrass-associated amphipod populations reach their peak densities during periods of high predator abundance.Ryer and Orth (1987) report that small size classes of G. mucronatus are a seasonally dominant prey item (spring, summer, fall) of the northern pipefish (Syngnathus fuscus) in the Lower Chesapeake Bay as well. Llanso et al. (1998) also indicate that G. mucronatus was among the preferred prey items of small red drum (Sciaenops ocellatus) in a restored mangrove impoundment in Tampa Bay. FL.Duffy and Hay (1994) describe a higher order trophic interaction involving G. mucronatus, the chemically defended brown seaweed Dictyota menstrualis, and predatory fish. The authors note that G. mucronatus is unable to palate D. menstrualis and must expose itself to seasonally abundant fish predators to find suitable food, leading to near-extinction of local populations when predators are moist abundant. In contrast, the amphipod Ampithoe longimana preferentially inhabits and consumes D. menstrualis. Experiments confirmed that A. longimana reduces its vulnerability to predation when occupying the chemically-defended seaweed which is avoided by fish. Habitats: Gammarus mucronatus occurs in a variety of estuarine and coastal habitats including seagrass beds, macroalgal mats, salt marsh, mud and sand flats, sponges, oyster reefs, and open beaches (Watling and Maurer 1972, Bausfield 1973, van Maren 1978, Nelson 1980).The strong phytal nature of G. mucronatus has been verified experimentally through observation of a greater that three-fold difference in the number of animals associated with algal substrate versus bare substrate in the laboratory (Masterson 1997). Activity Time: Active Gammarus mucronatus may be encountered during daylight and evening hours.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Gammarus mucronatus (Deposit feeding peracaridan crustaceans and detritivorous crustaceans) preys on:
algae
bacteria
Microfauna

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Gammarus mucronatus (Deposit feeding peracaridan crustaceans and detritivorous crustaceans) is prey of:
sediment POC

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Fredette and Diaz (1986a) recorded Gammarus mucronatus population densities in Virginia Zostera marina beds ranging from less than 50 individuals/m2 in the fall to nearly 1,200 individuals/m2 in the summer. These authors also report an early summer peak of 6,800 G. mucronatus individuals/m2 in a macroalgal-based (Ulva and Enteromorpha) community.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

As with all aphipods, reproduction is sexual, the sexes are separate, and fertilization is internal.Reproductive seasonality may vary with geography. Bousfield (1973) indicated ovigerous females are present from April-September in new England populations, but the reproductive season is longer in more southern populations. Fredette and Diaz (1986a) conservatively estimate that approximately 6 cohorts per year can develop before excessively high summer temperatures curtail reproduction.Data from the York River subestuary of Chesapeake Bay suggest the sex ratio in Gammarus mucronatus is generally close to 1:1 (Fredette and Diaz 1986a). The study also indicated that mature nonovigerous females were rare, with over 90% of all mature females carrying broods. The authors noted that minimum ovigerous size (ca. 1.1 mm) can be attained in as little as 10 days and mean ovigerous size (ca. 2.3 mm) can be attained in as little as 30 days at 23°C. Maturation in warm months and in warmer southern estuaries requires only a couple of weeks.Egg production is directly correlated to female body size and has been reported to range from a few eggs to more than 200 per brood. Egg size in the Virginia populations examined by Fredette and Diaz (1986a) ranged from 0.308 to 0.532 mm and eggs showed a seasonal decrease in size from winter to summer. The smaller egg sizes develop more quickly (Clarke, 1982).
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

The eggs are contained by the female within a thoracic brood pouch and yound hatch out as fully developed juveniles with no free-living larval stage. Mean brood development time has been reported to be just over 30 days at 6°C and 12 days at 10°C, compared to as little as 8.3 days and 4.3 days at temperatures of 17°C and 21°C, respectively (Steele and Steele 1975, Borowsky 1980, Fredette and Diaz 1986a).
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gammarus mucronatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTTTACTTTATTCTAGGTGCTTGGGCTAGAGTTTTAGGCACCTCTTTAAGGGTTATTATCCGGACTGAGCTCAGAGCTCCGGGTAATCTTATTGGGGATGACCAACTTTATAATGTTATAGTGACTGCACATGCCTTTGTTATGATTTTTTTTATAGTTATGCCAATTATAATTGGAGGGTTCGGAAATTGGCTTGTTCCTTTAATACTAGGCAGACCCGATATAGCTTTTCCTCGTATGAACAATATGAGATTTTGGTTATTACCCCCATCACTATCCTTGCTTTTAATGAGAGGCATAGTTGAAAGAGGAGTCGGCACTGGTTGAACAGTCTACCCTCCTTTAGCTGGCACAATTGCGCATAGCGGCGGCGCTGTAGACTTGGCAATCTTTAGCCTACACCTGGCCGGTGCTTCCTCTATTCTAGGGGCTATTAATTTTTTATCTACCGTAGTTAACATACGGGCACCTCGTATAGAGTTTGATCAGATACCTTTGTTTGTCTGGTCTGTGTTTATTACGGCCCTACTTCTCCTTCTTTCTCTACCTGTTCTGGCTGGGGCTATTACAATACTGCTCACAGACCGGAATTTAAATACTTCTTTTTTTGACCCTAGCGGGGGAGGAGACCCTATTCTCTACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gammarus mucronatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic/Ecological Importance: The species has no direct economic importance, but is a valuable system component from an ecological standpoint. In terms of secondary productivity, populations of seagrass-associated amphipods such as Gammarus mucronatus are extremely important ecosystem components. Fredette and Diaz (1986b) reported G. mucronatus secondary production values of 5-10 g dry wt./m2/year in York River Zostera marina beds, and values of more than 27 g dry wt./m2/year have been reported (Waters and Hokenstrom 1980). As noted, G. mucronatus is also an important prey item to many ecologically and commercially important species.Experiments conducted by Duffy and Hay (2000) led the authors to conclude that grazing amphipods in general may play important roles in the organization of benthic communities.
  • Bousfield EL. 1973. Shallow-water gammaridean Amphipoda of New England. Corell University Press, Ithaca, New York. 312p.
  • Hauxwell J, McClelland J, Behr PJ, and I Valiela. 1998. Relative importance of grazing and nutrient controls of macroalgal biomass in three temperate shallow estuaries. Estuaries 21:347-360.
  • Borowsky B. 1980. Reproductive patterns of three intertidal salt-marsh gammaridean amphipods. Marine Biology 55:327-334.
  • Bousfield EL. 1969. New records of Gammarus (Crustacea: Amphipoda) from the Middle Atlantic Region. Chesapeake Science 10:1-17.
  • Clarke A. 1982. Temperature and embryonic development in polar marine invertebrates. International Journal of Invertebrate Reproduction 5:71-82.
  • Duffy JE and ME Hay. 1994. Herbivore resistance to seaweed chemical defense: The roles of mobility and predation risk. Ecology 75:1304-1319.
  • Duffy JE and ME Hay. 2000. Strong impacts of grazing amphipods on the organization of a benthic community. Ecological Monographs 70:237-263
  • Duffy EJ, MacDonald KS, Rhode JM, and J. Parker. 2001. Grazer diversity, functional redundancy, and productivity in seagrass beds: An experimental test. Ecology 82:2417-2434.
  • Fredette TJ and RJ Diaz. 1986. Life history of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm eemperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology 6:57-78.
  • Fredette TJ and RJ Diaz. 1986. Secondary production of Gammarus mucronatus Say (Amphipoda: Gammaridae) in warm temperate estuarine habitats, York River, Virginia. Journal of Crustacean Biology, Vol. 6, No. 4, (Nov., 1986), pp. 729-741
  • Llanso RJ, Bell SS, and FE Vose. 1998. Food habits of red drum and spotted seatrout in a restored mangrove impoundment. Estuaries 21:294-306.
  • Masterson JW. 1997. Investigation of the effects of macrophyte structure, food resources and health on habitat selection and refuge value in vegetated aquatic habitats. Unpublished Ph.D. Dissertation. 145 p.
  • Nelson WG. 1979. Experimental studies of selective predation on amphipods: Consequences for amphipod distribution and abundance. Journal of Experimental Marine Biology and Ecology 38:225-245.
  • Nelson WG. 1980. The biology of eelgrass (Zostera marina L.) amphipods. Crustaceana 39:59-89.
  • Ryer CH and RJ Orth. 1987. Feeding Ecology of the Northern Pipefish, Syngnathus fuscus, in a Seagrass Community of the Lower Chesapeake Bay. Estuaries 10:330-336.
  • Sagasti A, Schaffner LC, and JE Duffy. 2000. Epifaunal communities thrive in an estuary with hypoxic episodes. Estuaries 23, No. 4:474-487.
  • Steele DH and VJ Steele. 1975. The biology of Gammarus (Crustacea, Amphipoda) in the northwestern Atlantic. XI. Comparison and discussion. Canadian Journal of Zoology 53:1116-1126.
  • Stoner AW 1980. The role of seagrass biomass in the organization of benthic macrofaunal assemblages. Bulletin of Marine Science 30:537-551.
  • van Maren MJ. 1978. Distribution and ecology of Gammarus tigrinus Sexton, 1939 and some other amphipod Crustacea near Beaufort (North Carolina, USA). Bijdragen tot de Dierkunde 48:46-56.
  • Waters TF and JC Hokenstrom. 1980. Annual production and drift of the stream amphipod Gammarus pseudolimnaeus in Valley Creek, Minnesota.-Limnology and Oceanography 25:700-710.
  • Watling L, and D Maurer. 1972. Marine shallow water amphipods of the Delaware Bay area, USA. Crustaceana, Suppl. 3:251-266.
  • Young DK, Buzas MA, and MW Young. 1976. Species densities of macrobenthos associated with seagrass: A field experimental study of predation. Journal of Marine Research 34:577-592.
  • Zimmerman R, Gibson R, and J Harrington. 1979. Herbivory detritivory among gammaridean amphipods from a Florida seagrass community. Marine Biology 54:41-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!