Overview

Brief Summary

Taxonomy

Unlike American or European lobsters spiny lobsters do not have large claws. Instead they defend themselves with their whip-like antennae. These have numerous spines that also occur on their body, which gives them their common name.The first part of their scientific name Panulirus derived from Palinurus the helmsman of Aeneas’ ship in Roman mythology, referring to their wandering habit. The second part, argus, refers to the giant of Greek mythology who had a hundred eyes. It is the four large ‘eye-spots’ on their tail that distinguishes P. argus from other spiny lobsters in the Caribbean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

Panulirus argus (the Caribbean spiny lobster) fishery is one of the most important in the Caribbean. Catches have declined by 55% in the last decade because of intensive fishing and change to their habitat.Spiny lobsters do not have large claws instead they defend themselves with their whip-like antennae.These animals are famous for their migratory marches. During autumn they head for deep water in long processions, single file. They are one of the few invertebrates capable of true navigation and may use ‘maps’ of the Earth’s magnetic field
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Young lobsters start off at just 2.5 cm and adults are typically about 10 cm from the tip of the antennae to the tail. It takes about 7 years to get to this size. Very few make it to 20 years old but these may reach 45 cm and weigh 4.5 kg.Because they have hard shell (exoskeletons) spiny lobsters have to shed them to grow. During this molt the lobster bulks up with water to expand the new exoskeleton. This then firms up and becomes hard within a week. Spiny lobsters molt about 4 times per year.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The carapace of Panulirus argus is subcylindrical and bears many strong, forward-facing spines. A pair of rostral horns projects forward over the stalked eyes. Whip-like antennae are longer than the body and are studded with small spines and setae. Antennules are also elongate, extending approximately 2/3 body length. The abdomen is notched along its lateral margins, but is otherwise smooth. Each segment of the abdomen has a transverse groove that is disrupted at the midline. The central telson is flanked by 2 pairs of biramous uropods. Body color is varied, but is generally a gray or tan base color mottled with shades of green, red, brown, purple, or black. The second and sixth segments of the abdomen have large yellow or white ocelli, with smaller ocelli scattered dorsolaterally along the abdomen. Legs are striped longitudinally in a dull blue color. Dactyls of the walking legs are setose. Pleopods are bright orange and black. The endopodites in female pleopods are well developed and hook-like, bearing many setae. In juveniles, antennae and pereopods are banded with white; and a broad white stripe runs the length of the dorsal midline across both the carapace and abdomen. Panulirus argus is sexually dimorphic, with females distinguished from males by differences in the sternum, legs and genital openings. In males, the sternum is somewhat broader and lacks the striations that are commonly found in females. The second pair of walking legs in males is more elongate than the other legs, and bears longer, curved dactyls. Females have small chelae on the dactyls of the fifth pair of walking legs. The raised genital openings of males are located ventrally, on the bases of the fifth pair of walking legs. In females, the gonopores are set at the bases of the third pair of walking legs. II . HABITAT AND DISTRIBUTION
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The Caribbean Spiny Lobster (Panulirus argus) occues in the Western Atlantic from Bermuda and North Carolina (U.S.A.) to Rio de Janeiro (Brazil), including the entire Gulf of Mexico and the Caribbean Sea. It has been reported twice from West Africa (Ivory Coast). (Holthuis 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

This species has a broad geographic range from Bermuda and east coast USA, south to Rio de Janeiro in Brazil, including the Caribbean Sea and the Gulf of Mexico (Holthuis 1991). It is also known from Cape Verde (Freitas and Castro 2005)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and ecology

Caribbean spiny lobsters occur throughout the shallow tropical and sub-tropical western Atlantic, from the coasts of Brazil up to North Carolina in the USA.During the day they hide from predators under reef crevices. Only at night do they come out to search for food. Using powerful mouths they break open shellfish and sea urchins for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spiny lobsters occur from North Carolina south to Brazil including Bermuda, the Gulf of Mexico, West Indies and Caribbean. The northernmost extent of the range is North Carolina (Williams 1984). Adults are most prevalent in nearshore and offshore waters, but are found throughout the Indian River Lagoon in areas where there is ample shelter. Juveniles commonly occur in seagrasses, mangrove creeks and oyster reefs.
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Panulirus argus reaches a maximum length of approximately 45 cm (1.47 feet), but is more commonly found at lengths of approximately 20 cm (7.9 inches). Growth in the first year averages 5 cm (1.5 inches), with growth thereafter averaging approximately 2.5 cm (1 inch) per year. Male and female growth rates are approximately equal in south Florida nursery areas (Davis and Dodrill 1980). Females tend to grow somewhat more slowly than males (Little 1972; Olsen and Koblick 1975) and do not achieve as large a size (Williams 1984).Spiny lobsters molt an average of 2.5 times per year, with most molting occurring from March - July, or from December - February in Florida (Williams 1984). Growth characteristics are correlated with age, with molt frequency and increment of growth at molting tending to decline with age (Aiken 1980). Variability in food quality and abundance, population density, water temperature, as well as rates of predation and injury, all affect growth rates in local populations. Eldred et al. (1972) estimated average growth rates in wild populations of Panulirus argus as 5 mm (0.2 inches) per month for the first 9 -10 months post-settlement in Biscayne Bay, Florida. Tagging studies in the same area showed that mean growth rates in 40-85 mm (1.6 - 3.3 inches) lobsters averaged 1.8 mm (0.07 inches) per month, with physical condition having a significant impact on growth rates. Davis (1981) reported that individuals having no injuries grew approximately 2.2 mm (0.09 inches) per month, while those missing legs and antennae grew only 1.3 mm (0.05 inches) per month. In Florida Bay, however, growth rates for injured and uninjured lobsters were approximately equal, at 3.3 mm (0.12 inches) per month (Davis and Dodrill 1980). In Key West, tagged lobsters 49-83 mm (1.9 - 3.3 inches) in length grew approximately 3.1 mm (0.12 inches) per month (Little 1972).Witham et al. (1968) reared pueruli of Panulirus argus under laboratory conditions over 7 months. During this time pueruli averaging 6 mm (0.2 inches) carapace length (CL) grew to an average of 34 mm (1.33 inches), with growth rates ranging from 3.8 - 4.2 mm (0.14 - 0.16 inches) per month. Other laboratory populations grew considerably more slowly, with Lewis et al. (1952) and Sweat (1968) reporting monthly growth rates less than 2 mm (0.07 inches) per month. Assuming a post-settlement growth rate of 4.0 mm (0.16 inches) per month, Panulirus argus likely reaches legal harvest size in 20 - 40 months, depending on location and degree of injury (Little 1972; Davis and Dodrill 1980).
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum body length of the Caribbean Spiny Lobster (Panulirus argus) is about 45 cm, with an average length of about 20 cm (Holthuis 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The Caribbean Spiny Lobster (Panulirus argus) has an antennular plate with 4 large spines arranged in a square; there are no scattered small spinules. The third maxilliped has an exopod with a flagellum. The transverse grooves of the abdominal somites have margins that are straight, not crenulated, where interrupted, they gradually narrow toward the middle of the body, rather than end abruptly. The color of the abdominal somites is reddish, brownish, or sometimes greenish, without transverse colour bands. A large eyespot of whitish or yellowish, surrounded by a dark colour, is present over the anterior end of the base of the pleura of abdominal somite 2; a similar (even slightly larger) spot is present on the anterolateral parts of somite 6. The tail fan has a broad transverse reddish band along or just before the posterior margin. (Holthuis 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Panulirus argus closely resembles a related species, the smoothtail spiny lobster, P. laevicauda, whose range is sympatric. The two are easily distinguished based on 2 characters: P. laevicauda lacks dorsal grooves on abdomen, but possesses a series of small white spots that run along the lateral margins of the abdomen.
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found up to a depth of 90 m within a range of habitat types, including rocky reefs, coral reefs and seagrass beds, which are utilized for shelter (Holthuis 1991).

In Florida, they typically moult 2 - 3 times a year from March to July, and December to February (Williams 1984). The timing of moulting is affected by water temperature/ geographic region (M.J. Butler, A.C. Cockcroft, A.B. MacDiarmid and R.A.Wahle pers. comm. 2008).

Egg production in females has been shown to be greatly reduced in fished populations, compared to unexploited populations, with females in the exploited population producing only 12% of eggs (Lyons et al. 1981). Age at maturity is estimated at 2 years, and longevity at 12 years (Chávez 2001) although individuals of 20 years have been noted (Ehrhardt 2005). Furthermore, size at maturity differs with locality. Estimates for size at 50% maturity range from 81 mm (CL) in Cuba, to 92 mm (CL) in Colombia (FAO 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 1 - 393
  Temperature range (°C): 23.535 - 27.084
  Nitrate (umol/L): 0.159 - 1.157
  Salinity (PPS): 35.580 - 36.315
  Oxygen (ml/l): 4.519 - 4.845
  Phosphate (umol/l): 0.097 - 0.193
  Silicate (umol/l): 0.868 - 1.769

Graphical representation

Depth range (m): 1 - 393

Temperature range (°C): 23.535 - 27.084

Nitrate (umol/L): 0.159 - 1.157

Salinity (PPS): 35.580 - 36.315

Oxygen (ml/l): 4.519 - 4.845

Phosphate (umol/l): 0.097 - 0.193

Silicate (umol/l): 0.868 - 1.769
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Caribbean Spiny Lobster (Panulirus argus) inhabits shallow waters, occasionally down to 90 meters and possibly even deeper. It is found among rocks, on reefs, in eelgrass beds, and in other habitats habitat that provide protection. (Holthuis 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of phyllosome larvae is not well described; however, those in culture consume chaetognaths, euphausids, fish larvae, and ctenophores (Provenzano 1968; Phillips and Sastry 1980). Pueruli are non-feeding (Lyons 1980). Benthic juveniles and adults are foragers that utilize chemoreceptive setae lining the antennules and walking legs assist in locating food sources (Ache and Macmillan 1980). Panulirus argus are often the dominant carnivores within their habitats, and likely effect the population sizes of other benthic species (Berry and Smale 1980). Typical prey items include a variety of slow-moving or sedentary organisms including gastropods, bivalves, crustaceans, annelids and echinoderms. Shelled organisms are manipulated with the legs and positioned near the mouth, where powerful mandibles can then crush or chip shells to extract prey.Competitors: Competition among lobster species in Florida is thought to be of little consequence as Panulirus argus is the dominant lobster species in Florida. A congener, P. laevicauda, though sympatric, is relatively scarce and generally found only in reef habitats (Marx and Herrnkind 1986); thus, little competition likely occurs.Predators: Panulirus argus larvae are consumed by a variety of pelagic fish species (Phillips and Sastry 1980). Pueruli are consumed by fishes as well as by benthic and epibenthic organisms such as crabs and octopods (Little and Milano 1980). Later juveniles and adults are armoured against predators both by their spiny exoskeletons and by their behaviors, with rapid tail-flipping the most commonly observed escape response. Spiny lobsters also resist predation by congregating together in shelters and blocking den openings (Lipcius et al. 1983). Large predators of juvenile and adult spiny lobsters include groupers (especially goliath groupers) (Crawford and De Smidt 1922), sharks, loggerhead turtles, and octopods (Kanciruk 1980). Habitats: Spiny lobsters are gregarious and migratory, most commonly found in coastal and shallow continental waters to depths of 90 m (295 feet) or more. The life cycle consists of 5 phases, each of which is habitat-associated. The oceanic, planktonic stage is characterized by the phyllosome larva. Phyllosomes inhabit the epipelagic zone of open ocean waters where temperature and salinity are relatively constant. Optimum survival occurs when conditions are stable and nonturbid, with no environmental pollutants. The swimming postlarval stage is characterized by the puerulus postlarva, which utilizes a broad range of nearshore and estuarine habitats, but settles primarily in well-vegetated habitats such as seagrasses meadows and algal beds. Algae, particularly the red alga Laurenia spp., appear to be especially important to newly settled postlarvae. The early benthic stage is characterized by the banded coloration pattern in young juveniles, which utilize mangrove creeks and vegetated shallow water. The late juvenile stage occurs in older juveniles, which utilize seagrasses and oyster reefs for as much as 2 years before migrating as sub-adults to shallow banks in nearshore waters. The adult stage is characterized by mature adults, which utilize hardbottom, patch reefs and coral reefs (Marx and Herrnkind 1986), commonly using crevices in coral reefs, overhangs, outcroppings, and other hard substrates for shelter. Adults use softbottom habitats and seagrasses primarily during migratory periods (Herrnkind et al 1975; Kanciruk 1980). Though adults often inhabit bays and estuarine habitats, they do not typically spawn there. Spawning occurs offshore in sheltered areas having low turbidity, low wave action and adequate larval transport by currents and waves (Kanciruk and Hernnkind 1976). Lobsters longer than 20 mm aggregate in shelters within protected bays and high salinity estuaries (Olsen et al. 1975; Davis 1979). Typical shelters include sponges, corals, mangrove roots, holes, rocky outcrops, and ledges. Davis (1971) reported juvenile spiny lobsters taking shelter under sea urchins. At approximately 70-80 mm, at the onset of sexual maturity, lobsters begin the migration to nearshore and offshore reefs. More females than males migrate offshore, with females tending to migrate into deeper waters in spring and summer for mating and larval release (Lyons et al. 1981). Both sexes migrate offshore in fall and winter months as severe fall storms arrive and water temperatures begin to decrease (Davis 1977; Herrnkind 1982). On occasion, mass migration of spiny lobster occurs, with lobsters forming single-file lines that stretch long distances (Kanciruk and Herrnkind 1978; Marx and Herrnkind 1986). Offshore populations consist primarily of adults that live communally or singly in crevices of rocks and corals, with most lobsters showing high site fidelity (Herrnkind et al. 1975). Spiny lobsters are relatively selective when choosing den sites and show a preference for those that allow complete concealment, exclude large predators, and contain other lobsters (Herrnkind et al 1975). Activity Time: Juveniles and adults are primarily nocturnal, with juveniles being somewhat more nomadic (Marx and Herrnkind 1986).
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Caribbean spiny lobsters are social animals and live in groups. When attacked the whole group will come together in a defensive pod and stick their spiny antennae straight up at the predator. This makes it difficult to pick off any one lobster.When they move their antennae the base rubs against a ‘file’ on their body, making a rasping noise to repel predators. Spiny lobsters are the only animals that make sound in this way.They are fussy when it comes to selecting den-mates and will shun any diseased individuals. Remarkably, they can tell if a lobster is infected even before it shows signs of being sick.These animals are famous for their migratory marches. During autumn they head for deep water in long processions, single file. They are one of the few invertebrates capable of true navigation and may use ‘maps’ of the Earth’s magnetic field to do this.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

The Caribbean Spiny Lobster (Panulirus argus) is gregarious and migratory. Females move to deeper water for spawning and there are mass migrations in the autumn when the animals, in single files of up to 50 individuals, move together in a certain direction during the day, each animal having body contact with the next via their antennae. (Holthuis 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Panulirus argus reach sexual maturity at lengths of approximately 70 - 80 mm (2.8 - 3.2 inches) (Witham et al 1968. Olsen et al 1975, Davis 1979). Adult male and females often inhabit estuaries, bays, and lagoons; but spawning typically occurs in nearshore and offshore reef fringes and other hardbottom areas from late spring through summer in Florida waters (Davis 1975; Kanciruk and Herrnkind 1976; Lyons et al. 1981). Annual variation in peak spawning period is dependent on water temperature. Lyons et al. (1981) reported spawning begins when water temperatures reach 24º C in deeper reef areas. In Florida, there is little evidence that spiny lobsters spawn more than once per year; however, in Bermuda, evidence supports multiple spawning (Sutcliffe 1952). Mating follows short courtships that involve signals being given by both sexes. In copulation, males hold females sternum to sternum and extrude a spermatophore which is adhered to the female's sternum, and will remain until the time of spawning. Sperm may be viable for as long as a month (Marx and Herrnkind 1986). Spawning occurs when females flex the abdomen under the carapace, spreading the telson and uropods, as well as the pleopods. Eggs are shed onto the abdomen, while the female scratches at the spermatophore to liberate sperm and fertilize eggs as they are extruded. Fecundity varies with body size. Females 71-75 mm (2.8 - 3 inches) in length carry approximately 230,000 eggs; while females over 100 mm (3.9 inches) carry more than 700,000 eggs (Mota-Alves and Bezerra 1968). Williams (1984) reported females 23 cm (9.1 inches) with 500,000 eggs, 30 cm (11.8 inches) with 1.18 million eggs, and 38 cm (15 inches) with 2.6 million eggs. Using the Index of Reproductive Potential (IRP) Lyons et al. (1981) estimated that female Panulirus argus in the upper Florida Keys measuring 76-85 mm (3.0 - 3.3 inches) carapace length (CL) contribute 48% of all egg production in the population. Females over 85 mm (3.3 inches) CL comprise approximately 20% of the female population, but contribute 41% of egg production. Females smaller than 76 mm (3.0 inches) comprise approximately 25% of all females, but contribute 11 % of all eggs. Minimum spawning size has declined in Florida Panulirus argus females, perhaps as a response to intense fishing pressures. In 1922, minimum spawning size of females was reported to be 76mm (3.0 inches) (Crawford and De Schmidt 1922). Recent surveys have revealed reproductive females as small as 65 mm- 71 mm (2.6 - 2.8 inches) in south Florida (Warner et al. 1977; Lyons et al 1981). However, unfished populations in the Dry Tortugas area show the minimum size in egg-bearing females to be 78 mm (3.1 inches) (Davis 1975). Suggested reasons for this decline in minimum spawning size have been genetic selection; modified sexual behavior when large females become rare; and reduced growth rates (Davis 1975; Warner et al. 1977; Lyons et al 1981). Decline in size of mature females has caused a marked reduction in reproductive potential, with Lyons et al. (1981) estimating that egg production in Florida Keys spiny lobsters was only 12% of that expected from a similarly sized, unfished population (Lyons et al. 1981).
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the northern part of its range, larvae of the Caribbean Spiny Lobster (Panulirus argus) are found mainly from June to December (Holthuis 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Eggs are bright orange in color and measure approximately 0.5 mm (0.02 inches) In diameter. Upon being extruded, eggs adhere to hook-like setae of pleopods located on the underside of the abdomen. They will remain in place until hatching at approximately 3 weeks. Several days before hatching occurs, eggs turn a darker brown color. Eggs hatch as transparent phyllosome larvae and are dispersed into the water column by repeated flexing of the female's abdomen. A second, smaller spawning may occur in Caribbean and West Indies populations about 1 week after release of eggs, though there is no evidence that a second spawning occurs in Florida waters. Following a second spawning, the ovary is usually spent, and the spermatophore erodes. Molting typically occurs after spawning. (William 1984). Phyllosomes are transparent and morphologically adapted for long planktonic existence being transported on oceanic currents for 6-12 months before metamorphosis to the postlarval stage (Lyons et al 1981). Phyllosomes are dorsoventrally flattened and have a bi-lobed cephalothorax. Appendages are long and setose to assist in floatation in the water column. Swimming is accomplished by flexion in the exopodites of the legs (Provenzano 1968). Phyllosomes vertically migrate on a daily basis, ascending to surface waters at night, and descending during the day (Sims and Ingle 1967). There are 11 stages of phyllosome development. During this period, larval size increases from 2 mm (0.07 inches) total length (TL) at hatching to approximately 34 mm (1.3 inches) before the metamorphosis to the postlarval puerulus stage. Pueruli persist for several weeks, are nonfeeding and oceanic (Lyons 1980). Like phyllosomes, they are dorsoventrally flattened and transparent, with no calcification in the carapace. Pueruli return to coastal waters from offshore, swimming shoreward at night, and tending to remain within a few centimeters of the water surface (Lyons 1980). Pueruli enter estuarine habitats throughout the year, with peaks occurring during new and first-quarter moons (Sweat 1968; Little and Milano 1980). Peak recruitment varies from year to year, but the main peak typically occurs in spring, followed by a lesser peak in the fall (Lyons 1980). Upon encountering suitable inshore substrates, pueruli settle to the benthos, typically in vegetated areas of algal beds, mangrove areas where prop roots are fouled by algae, seagrasses, small holes, and sand-mud bottoms (Witham et al 1964). Several days before the molt to the first juvenile stage, they begin to show signs of pigmentation, turning a red-brown color. Benthic juveniles are cryptically colored in varying shades, and have banding and striping that aids in camouflage. Young juveniles tend to be solitary and behave aggressively toward conspecifics, lashing them with antennae, or prying at them to dislodge them from refuges (Marx and Herrnkind 1986). However, an ontogenetic shift occurs to more social, gregarious behavior as body size increases. This shift appears to be at least partially dependent on the distribution and quality of shelters available (Marx and Herrnkind 1986).
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Underwater sensors detect odors: spiny lobster
 

Antennules of the spiny lobster trap water to identify odors using chemosensory hairs.

     
  "lobster olfactory antennules hydrodynamically alter the spatiotemporal patterns of concentration in turbulent odor plumes. As antennules flick, water penetrates their chemosensory hair array during the fast downstroke, carrying fine-scale patterns of concentration into the receptor area. This spatial pattern, blurred by flow along the antennule during the downstroke, is retained during the slower return stroke and is not shed until the next flick." (Koehl et al. 2001:1948)
  Learn more about this functional adaptation.
  • Koehl, MAR; Koseff, Jeffrey R; Crimaldi, John P; McCay, Michael, G; Cooper, Tim; Wiley, Megan B; Moore, Paul A. 2001. Lobster sniffing: Antennute design and hydrodynamic filtering of information in an odor plume. Science. 294(5548): 1948-1951.
  • Chang, C.; Chiang, C. F.; Liu, C. H.; Liu, C. H. 2005. A lobster-sniffing-inspired method for micro-objects manipulation using electrostatic micro-actuators. Journal of Micromechanics and Microengineering. 15(4): 812-821.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus argus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGCATGAGCTGGAATGGTGGGAACTTCCCTAAGACTTATTATTCGAGCTGAATTAGGTCAACCAGGCAGATTTATCGGAGAC---GATCAAATCTACAACGTAGTAGTAACCGCTCACGCCTTTATTATGATTTTCTTCATGGTTATGCCCATTATAATCGGAGGGTTTGGAAATTGATTAGTCCCTATTATACTAGGAGCTCCCGATATAGCTTTCCCCCGAATGAATAACATGAGATTTTGACTTCTTCCCCCATCGCTAACGCTTCTTCTGGCTGGAGGAGCCGTAGAAAGAGGAGCTGGAACCGGTTGAACAGTTTATCCCCCTCTTTCGGCCGGAGTGGAACACGCTGGTGCGTCAGTGGACTTAAGTATCTTTTCACTACACCTAGCAGGTGTTTCATCCATTCTTGGAGCCGTCAACTTTATTACTACCGTCATCAATATACGGTCATCTGGGATAACGCTAGATCGAATACCTCTCTTTGTTTGATCTGTTTTCATTACAGCTATCCTATTACTTCTTTCGCTCCCTGTGCTAGCCGGAGCCATTACGATACTTTTAACTGATCGAAACCTTAACACTTCCTTTTTCGACCCAGTAGGAGGAGGAGACCCCATCCTATACCAACATTTATTCTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus argus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 329
Specimens with Barcodes: 359
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 7 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Butler, M., Cockcroft, A., MacDiarmid, A. & Wahle, R.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification
Panulirus argus has been assessed as Data Deficient. Although this species is believed to be exploited throughout its range, there are gaps in the data relating to fishing effort, or other appropriate indexes of abundance. For the major producers of this species, both Cuban and Florida fisheries are thought to be relatively stable, however Nicaraguan, the Bahamas and Brazilian fisheries are uncertain. Further research is required to determine an appropriate index of abundance for the global population of this species, and to what extent it is impacted by harvesting and other threats within its range, before an accurate assessment can be made. With further information on catch per unit effort, it is likely that this species will be uplisted to a threat category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widely distributed within the western central Atlantic and supports important fisheries in many of the countries within this area. However, recent assessments have indicated this species is being fully or over-exploited over much of its range (Cochrane and Chakalall 2001).

Four stocks have been identified by the FAO (2001) according to the nature of the coastal shelf and prevailing currents which thereby affect recruitment. These stocks detail the major lobster producing countries, although there are many other countries that also utilize this resource:

Southern Stock: Brazil, Venezuela, Dominican Republic and Lesser Antilles.

South Central Stock: Colombia, Nicaragua, Honduras and Jamaica.

North Central Stock: Mexico, Belize and southern Cuba.

Northern Stock: North Cuba, USA (Florida), Bahamas, Turks and Caicos and Bermuda.

Landings of this species over the last 50-60 years, have fluctuated significantly, peaking at 37,500 tonnes in 1995/1996. Both the Northern and Southern stocks have shown an increase in landings, while the South Central stock appears to have stabilized, and the North central stock has shown a decline (FAO 2006). The biggest producing countries include Cuba, the Bahamas, Brazil, Nicaragua and the USA, which in 1998 accounted for over 88% of the global landings. This species is harvested using a number of gear types including traps, gill nets, by hand (divers), and aggregating devices known as 'pesqueros' or 'casitas' (FAO 2006).

Bahamas: Stock biomass abundance (as estimated from length cohort analysis) is reported to be showing a declining trend of 33% between 1992 and 2001 when it peaked at 24 million pounds and declined to 16 million pounds. There has also been a decline in the average size of lobsters since 1991/1992 when average tail weight peaked at 7.95 oz and declined to ~7.45 in 2001/2002 (Gittens and Braynen 2002).

Bermuda: Between the 1950s and early 1970s catches of this species fluctuated between 150 and 200 tonnes with a peak in 1968 at 250 tonnes. As of the 1970s there was a decline in catch to between 10 and 40 tonnes per annum. This decline in landings is likely a result of a conservation program started in 1975 which prohibited the removal of individuals less than 92 mm (CL); a closed fishing season between 1st April and 31st August over the breeding season; prohibition of the removal of berried females; protection of juveniles in nursery areas around the North Shore and inshore waters of the sounds and harbours (Evans and Evans 1995). Catch per unit effort (CPUE) is seen as an appropriate index of abundance when studying the Bermuda population, as annual sea temperatures fluctuate very little in this region and thereby have little effect on the catchability coefficient. During the period 1975-1986 there was an overall increase in CPUE from just 0.4 lobsters trap/ haul to above 0.6 lobsters trap/ haul (Evans and Evans 1995). During the period 1996-2001 CPUE was reported as relatively stable for the offshore fishery while the inshore fishery has shown a declining trend. In 2001/2002 fishing effort was reduced; total landings were still down in this season but CPUE was significantly higher (2.29 in 2001/2002 compared to 1.70 in 2000/2001) (Trott, Luckhurst and Medley 2002).

Belize: There has been a significant decline in the CPUE in the spiny lobster fishery in this region from ~1.2 kg/trap in 1965 to 0.6 kg/trap in 1997. There are also reports that 10% of the landings consist of undersized individuals (Carcamo 2003).

Brazil: Since 1959, there has been a significant increase in the landings of this species from 1,000 tonnes to over 10,000 tonnes in the early 1990's. There has since been a subsequent decline to annual landings ranging from 6,000 to 8,000 tonnes (FISHSTAT Plus 2000). During the period 1974 to 1993 CPUE declined from ~0.30 to ~0.15 (FAO 2001), a decline of ~50%. Abundance estimates (estimated by tuned length cohort analysis) show a significant decline since 1993 from ~25 to 30 million down to around 15 million in 1997. During this period there was a number of new fishing vessels entering the fleet, as well as an increase in the use of gillnets, traps, scuba divers and free divers. However the stock abundance of this fishery is largely driven by variable levels of recruitment which are brought about by environmental changes such as ENSO events. This in combination with a growing intensity in the fishing fleet could result in ongoing declines in abundance (FAO 2001).

Cuba: There are four lobster management zones in Cuba: North Western which accounts for approximately 2% of the landings; North Eastern which accounts for approximately 15% of the landings; Gulf of Batabano which accounts for approximately 60% of the landings; South Eastern which accounts for approximately 23% of the landings (Cruz and Adriano 2001). In 1953, landings of this species increased from approximately 1,000 tonnes per year to a peak of 13,578 tonnes in 1985. There has since been a subsequent decline to 4,401 tonnes in 2006. This species is of huge economic importance to Cuba and represents approximately 60% of the country's gross income from fisheries (Baisre and Cruz 1994). The particularly high landings from 1978 to 1988 was largely due to an increase in fishing effort. Cruz and Phillips (1994) found the number of pesqueros deployed on the fishery rose from 440,000 in 1975 to 856,000 in 1983 and 1,230,600 in 1987, as well as strict compliance with minimum legal size limits, and the closed fishing season (Puga et al. 1992). The decline in catch as of 1988 may be in part due to hurricane Gilbert which is thought to have affected lobster nursery grounds (Cruz Font 2002). Ninety percent of the lobster catch is comprised of lobsters aged 2 to 6 with 55% aged 3 to 4 (Cruz Font 2002). In the report by Cruz Font (2002) their calculations indicate that an increase in current fishing effort could result in higher catch as actual fishing mortality is lower than maximum yield, however this does not take account of the resulting effect on spawning stock biomass. The authors recommend that instead of defining a biological reference point (BRP) based on yield per recruit such as Fmax and F0.1 , they recommend adopting a view which focuses on spawning stock or egg production in order to preserve reproductive potential (calculated as reference fishing mortality Fx% representing a spawning stock biomass per recruit that is x% of that with no fishing). A BRP of 35-50%, based on spawning biomass, is recommended.

Jamaica: There has been an ongoing increase in the landings of this species since the early 1980's. Landings then peaked at ~700 tonnes in 2005. During this time intensity of the fishing fleet has increased significantly, however CPUE data is not available due to lack of cooperation from fishers (Kelly 2002).

Nicaragua: Over the history of this fishery, effort has increased linearly. Rates of fishing mortality (F) have reached levels of 0.53 per year while natural mortality is calculated at 0.35 per year. Regulations include annual fishing quotas which are defined by changes in annual recruitment; prohibition of fishing during periods of maximum recruitment and egg-laying (May-June); prohibition on removal of berried females. However at present there is no effective means to monitor or control these regulations. There has also been a decline in the mean length of individuals being harvested from 163 mm in 1990/1991 to 159 mm in 2002/2003 indicating growth-overfishing. Biomass estimates were obtained by means of length cohort analysis and indicate considerable fluctuations over the period 1990 - 2002. In the season 1998/1999 abundance fell to below 3,636 tonnes, while in season 1999/2000 it exceeded 5,454 tonnes but subsequently declined to below 3,636 tonnes in 2001/2002. The decline in 1998/1999 could be related to the effect of hurricane Mitch on nursery grounds and thereby affecting recruitment (Navarro 2002).

Puerto Rico: Over the period 1988-2001, landings of this species rose from ~150,000 pounds to 250,000-300,000 pounds per year (Matos-Caraballo et al. 2007). During this time CPUE for each gear type has also shown an increase. Average size of individuals has increased from the period 1988-1994 to 1995-2001 perhaps as a result of good enforcement of the minimum size limit (Matos-Caraballo et al. 2007).

Florida, United States of America-Since the 1970s the landings of this species have been fairly stable with some fluctuation occurring. Prior to this CPUE peaked at over 100 lbs/trap and then declined to ~10 lbs/trip in 1975. Since the fishing season of 1990/1991 the catch rate per trip has been steadily increasing from ~0.75 pounds/trip to ~1.12 pounds/trip in 1999/2000. Spawning stock biomass of females has also increased during the period 1993/1994 - 1999/2000 from ~2.5 million pounds to ~3 million pounds, while male biomass has shown some variability between ~1.8 and ~2.3 million pounds (Muller et al. 2000). Recruitment levels appear to be higher following the Trap Reduction Program which was implemented in 1992/1993, with numbers of age 2 lobsters rising from an average of 9.1 million lobsters, to 12.6 million lobsters (Muller et al. 2000). In 2000, Matthews considered the fishery to be in a stable state.

Venezuela: During the period 1950-1977, the landings of this species fluctuated between 100-200 tonnes per annum. Between 1977 and 1993 the landings then showed more dramatic fluctuations between 250 and 1200 tonnes per annum. This was followed by a subsequent decline to approximately 100 tonnes from 1998-2001 but has since shown an increase to approximately 1,100 tonnes. There is no formal data on fishing effort in Venezuela although sporadic reports have been made by Parque Nacional Archipiélago los Roques (PNALR). From 1994 to 1997, free divers CPUE is said to have decreased significantly (5,157 kg per diver per season to 2,966 kg per diver per season), while trap catches are thought to have increased during this same period from 80.2 kg per trap per season, to 93.2 kg per trap per season in 1996, and 90.8 kg per trap per season in 1997 (FAO 2001). At present ~95% of the landings of this species are derived from Los Roques Archipelago National Park (Yallonardo et al. 2001). Size frequency of lobsters taken during the period 1986-1988 and 1998-1999 did not differ significantly indicating that growth overfishing does not appear to be a problem. Mean CPUE by trapping increased from 2.29 kg/trap/month in 1986-1988, to 2.31 kg/trap/month in 1998-1999, and CPUE by diving increased from 133 kg/diver/month in 1986-1988, to 155.65 kg/diver/month in 1998-1999 (Yallonardo et al. 2001). While a decline in the landings was noted in the trap fishery (158,363 kg to 93,555 kg) this is likely related to a decline in the number of traps being used over this time period (275 traps to 225 traps) (Yallonardo et al. 2001). While the conclusion of this study implicates stability in the fishery, the authors note that only a single data point was used for the period 1986-1988.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
A major threat to this species is disease (PAV1) which effects one in four recruits in the Caribbean (M. Butler pers. comm. 2009), which could be contributing to the declines in the population. Furthermore, climate change related impacts could possibly be contributing to the resilience of this species to the disease. This species is a also commercially and recreationally caught species and over-exploitation has caused declines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are regulations in place governing the harvesting of this species within part of its range. There is a legal minimum size of 69 mm (carapace length) and a closed season of 120 days from February to May, in order to safeguard reproducing females during the spawning period, to protect new recruits, and to allow the growth and increase in weight of the population (Phillips and Melville-Smith 2006). Furthermore, strict control is also exercised over the prohibition of the taking of berried females, as well as the number of fishing gears and boats utilized, and boat replacement (Baisre and Cruz 1994).

Further research is needed to determine an appropriate index of abundance for the global population of this species, and to what extent it is impacted upon by threats within its range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Fishery

The spiny lobster fishery is one of the most important in the region.At its peak from 1987 to 1997 about 34 metric tons were caught yearly, worth over US$300,000 to the fishermen. In the last decade catches have declined by 55% because of intensive fishing and change in habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Commercially important. Fisheries Importance:The statewide commercial catch of spiny lobsters is the second most valuable Florida shell fishery, second only to shrimp. Since 1970, the commercial catch has ranged without trend between 4.3 million - 7.9 million pounds per year (Muller 2003). Between 1987 - 2001, the commercial harvest of Panulirus argus in Florida totaled 94.6 million pounds, and was valued at $365.3 million. Most landings occur on the Gulf coast and in Monroe and Dade counties on the East coast. Generally less than 1.5 million pounds of spiny lobsters are landed outside the vicinity of the Florida Keys each year (Muller 2003), and this is reflected in the relatively low annual value of the spiny lobster catch to IRL counties. Commercial lobstermen using traps account for approximately 80% of the total catch, with recreational divers harvesting 20%. The 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties) accounted for 607,890 pound of the commercial harvest, which had a value of $2.3 million. This ranks the spiny lobster twenty-third in commercial value to IRL counties, and forty-fourth in pounds harvested. Figure 1 below shows the dollar value of the spiny lobster commercial fishery to IRL counties by year. The fishery ranged in value from a high of $260,838 in 2001, to a low of $68,113 in 1988. Brevard County accounted for the largest share of the catch at 53.3%, followed distantly by Martin (15.3%), St. Lucie (13.3%),Volusia (13.2%) and Indian River(4.9%) Counties. Recreational Fishery: Beginning in 1991, the Florida Fish and Wildlife Conservation Commission began utilizing mail surveys to estimate the recreational harvests of spiny lobster by recreational fishers during the 2-day mid-summer sport season, and the regular season, which opens in early August and runs through late March. In a typical year, the recreational harvest of spiny lobsters averages 20 - 22% of the commercial catch with approximately 2 million pounds of lobster harvested (Eaken 2001). Harvest regulations for spiny lobsters state the carapace must be longer than 3 inches as measured from the groove between eyes to the end of carapace. Recreational harvesting requires a saltwater fishing license. Recreational anglers must measure lobsters in the water and immediately release undersized animals and females with eggs. The bag limit in most areas is 6 lobsters per person per day.
  • Ache, B.W., and D.L. Macmillian. 1980. Neurobiology. Pages 215-268 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Acosta, C.A., T.R. Matthews, and M.J. Butler IV 1997. Temporal patterns and transport processes in recruitment of spiny lobster (Panulirus argus) postlarvae to south Florida. Mar. Biol. 129:79-85.
  • Aiken, D.E. 1980. Molting and growth. Pages 91-147 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Berry, P.F., and M.J. Smale. 1980. An estimate of production and consumption rates in the spiny lobster Panulirus homarus on a shallow littoral reef off the Natal coast, South Africa. Mar. Ecol. Prog. Ser. 2:337-343.
  • Bos, A.R., S. Clark and S. Gore. 2003. Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the Gulf and Caribbean Fisheries Institute 54:230-240.
  • Buesa, R.J. 1979. Oxygen consumption of two tropical spiny lobsters, Panulirus argus (Latreille) and P. guttatus (Latreille) (Decapoda, Palinuridae). Crustaceana 36:100-107.
  • Butler, M.J., J.H. Hunt, W.F. Herrnkind, M.J. Childress, R. Bertelsen, W. Sharp, T. Matthews, J.M.Field, and H.G. Marshall. 1995. Cascading disturbances in Florida Bay, USA: Cyanobacteria blooms, sponge mortality, and implications for juvenile spiny lobsters Panulirus argus. Marine Ecology Progress Series 129:119-125.
  • Butler, M.J. IV and W.F. Herrnkind 1991. The effect of benthic microhabitat cues on the metamorphosis of spiny lobster, Panulirus argus, postlarvae. J. Crustacean Biol. 11:23-28.
  • Cox, C., J.H. Hunt. 2005. Change in size and abundance of Caribbean spiny lobsters Panulirus argus in a marine reserve in the Florida Keys National Marine Sanctuary, USA. Marine Ecology Progress Series 294:227-239.
  • Cox, C., J.H. Hunt, W.G. Lyons, and G.E. Davis. 1997. Nocturnal foraging of the Caribbean spiny lobster (Panulirus argus) on offshore reefs of Florida, USA. Mar. Freshwater Res. 48:671-679.
  • Calinski, M.D., and W.G. Lyons 1983. Swimming behavior of the puerulus of the spiny lobster Panulirus argus (Latreille, 1804) (Crustacea: Palinuridae). J. Crustacean Biol. 3:329-335.
  • Crawford, D.R. and W.J.J. DeSmidt. 1922. The spiny lobster, Panulirus argus, of southern Florida: its natural history and utilization. Bull. Bur. Fish. 38:282-310.
  • Davis, G.E. 1971. Aggregations of Spiny sea urchins, Diadema antillarum, as shelter for young spiny lobsters, Panulirus argus. Trans. Am. Fish. Soc. 100:586-587.
  • Davis, G.E. 1975. Minimum size of mature spiny lobsters, Panulirus argus, at Dry Tortugas, Florida. Trans. Am. Fish. Sot. 104: 675-676.
  • Davis, G.E. 1979. Management recommendations for juvenile spiny lobsters, Panulirus argus in Biscayne National Monument, Florida. U.S. Dep. Inter. So. Fla. Res. Rep. M-530. 32 pp.
  • Davis, G.E. 1977. Effects of recreational harvest on spiny lobster, Panulirus argus, population. Bull. Mar. Sci. 27:223-236.
  • Davis, G.E. 1981. Effects of injuries on spiny lobster, Panulirus argus, and implications for fishery management. U.S. Natl. Mar. Fish. Serv. Fish. Bull. 78:979-984.
  • Davis, G.E. and J.W. Dodrill 1989. Recreational fishery and population dynamics of spiny lobsters, Panulirus argus, in Florida Bay, Everglades National Park, 1977-1980. Bull. Mar. Sci. 44:78-88.
  • Eaken, D. 2001. Surveying recreational lobster fishers. Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institute. http://www.floridamarine.org/features/view_article.asp?id=8140.
  • Eggelston, D.B. E.G. Johnson, G. T. Kellison and D.A. Nadeau. 2003. Intense removal and non-saturating functional responses by recreational divers on spiny lobster Panulirus argus. Marine Ecology progress Series 257:197-207.
  • Eldred, B., C.R. Futch, and R.M. Ingle. 1972. Studies of juvenile spiny lobsters, Panulirus argus, in Biscayne Bay, Florida. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 35. 15 pp.
  • Field, J.M. and M.J. Butler IV 1994. The influence of temperature, salinity, and postlarval transport on the distribution of juvenile spiny lobsters, Panulirus argus (Latreille, 1804) in Florida Bay. Crustaceana. 67:26-45.
  • George, R.W., and A.R. Main. 1967. The evolution of spiny lobsters (Palinuridae): study of evolution in the marine environment. Evolution. 21:803-820.
  • Herrnkind, W.F. 1980. Spiny lobsters: patterns of movement. Pages 349-407 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 1. Academic Press, New York.
  • Herrnkind, W.F. and J.J. Butler IV 1986. Factors regulating postlarval settlement and juvenile microhabitat use by spiny lobsters, Panulirus argus. Mar. Ecol. Prog. Ser. 34:23-30.
  • Herrnkind, W.F., M.J. Butler IV, and R.A. Tankersly 1988. The effects of siltation on recruitment of spiny lobsters, Panulirus argus. Fish. Bull. 86:331-338.
  • Herrnkind, W.F., P. Jernakoff, and M.J. Butler IV 1994. Puerulus and post-puerulus ecology. In: Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka. Blackwell Scientific Press, Oxford, pp 213-229.
  • Herrnkind, W.F., J. Vanderwalker, and L. Barr. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: habitation and pattern of movements. Results of the Tektite Program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 31-45.
  • Holthuis, L. B. 1991. Marine lobsters of the world: an annotated and illustrated catalogue of species of interest to fisheries known to date. FAO Fisheries Synopsis, no. 125, vol. 13. Food and Agriculture Organization of the United Nations. Rome, Italy
  • Hunt, J.H. and W.G. Lyons 1986. Factors affecting growth and maturation of spiny lobsters, Panulirus argus, in the Florida Keys. Can J. Fish. Aquat. Sci. 43:2243-2247.
  • Kanciruk, P. 1980. Ecology of Juvenile and adult Palinuridae (Spiny Lobsters). In: The Biology and Management of Lobsters. Vol II. Ecology and Management. Edited by J.S. Cobb and B.F. Phillips. Academic Press, New York. pp. 59-96.
  • Kanciruk, P., and W.F. Herrnkind. 1976. Autumnal reproduction of spiny lobster, Panulirus argus, at Bimini, Bahamas. Bull. Mar. Sci. 26:417-432.
  • Kittaka, J. 1994. Larval rearing. In Spiny Lobster Management. Edited by B.F. Phillips, J.S. Cobb, and J. Kittaka, Blackwell Scientific Press, Oxford, pp. 402-423.
  • Lewis, J.B. 1951. The phyllosoma larvae of the spiny lobster, Panulirus argus. Bull. Mar. Sci. Gulf. Carib. 1:89-103.
  • Lewis, J.B., H.B. Moore, and W. Babis. 1952. The postlarval stages of the spiny lobster Panulirus argus. Bull. Mar. Sci. 2:324-337.
  • Lipcius, R.N., M.L. Edwards, W.F. Herrnkind, and S.A. Waterman. 1983. In situ mating behavior of the spiny lobster Panulirus argus. J. Crust. Biol. 3:217-222.
  • Little, E.J. 1972. Tagging of spiny lobsters (Panulirus argus) in the Florida Keys, 1967-69. Fla. Dep. Nat. Resour. Mar. Res. Lab. Spec. Sci. Rep. 31. 23 pp.
  • Little, E.J. 1977. Observations on recruitment of postlarval spiny lobster, Panulirus argus, to the south Florida coast. Fla. Mar. Res. Publ. No. 29. 35p.
  • Little, E.J., and G.R. Milano. 1980. Techniques to monitor recruitment of postlarval spiny lobsters. Panulirus argus, to the Florida Keys. Fla. Mar. Res. Publ. No. 37. 16 pp.
  • Lyons, W.G. 1980. The postlarval stage of scyllaridean lobsters. Fisheries 5:47-49.Lyons, W.G. 1981. Possible sources of Florida's spiny lobster population. Proc. Gulf Caribb. Fish. Inst. 33:253-266.
  • Lyons, W.G., D.G. Barber, S.M. Foster, F.S. Kennedy, Jr., and G.R. Milano. 1981. The spiny lobster, Panulirus argus, in the middle and upper Florida Keys: population structure, seasonal dynamics, and reproduction. Fla. Mar. Res. Publ. No. 38. 38 pp.
  • Marx, J.M. 1986. Recruitment and settlement of spiny lobster pueruli in south Florida. Can J. Fish. Aquat. Sci. 43:2221-2227.
  • Marx, J.M., and W.F. Herrnkind. 1986. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (south Florida)--spiny lobster. U.S. Fish Wildl. Serv. Biol. Rep. 82(11.61). U.S. Army Corps of Engineers, TR EL-82-4. 21 pp.
  • Mota-Alves, M.I., and R.C.F. Bezerra. 1968. Sobre o numero de ovos da lagosta Panulirus argus (Latr.). Arq. Estac. Biol. Mar. Univ. Fed. Ceara 8:33-35.
  • Muller, R. 2003. Caribbean Spiny Lobster (Panulirus argus). Florida Marine Research Institute. http://floridamarine.org/engine/download_redirection_process.asp?file= lobster_3401.pdf&objid=4808&dltype=article
  • Neveitt, G., N.D. Pentcheff, K.J. Lohmann, R.K. Zimmer. 2000. Den selection by the spiny lobster Panulirus argus: testing attraction to conspecific odors in the field. Marine Ecology Progress Series 202:225 - 231.
  • Olsen, D.A., W.F. Herrnkind, and R.A. Cooper. 1975. Population dynamics, ecology, and behavior of spiny lobster Panulirus argus, of St. John, U.S. Virgin Islands: introduction. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20:11-16.
  • Olsen, D.A., and I.G. Koblick. 1975. Population dynamics, ecology, and behavior of spiny lobster, Panulirus argus, of St. John, U.S. Virgin Islands: growth and mortality. Results of the Tektite program, Vol. 2. Nat. Hist. Mus. Los Ang. Cty. Sci. Bull. 20: 17-21.
  • Phillips, B.F., and A.M. Sastry. 1980. Larval ecology. Pages 11-48 in J.S. Cobb and B.F. Phillips, eds. The Biology and Management of Lobsters, Vol. 2. Academic Press, New York.
  • Provenzano, A.J. 1968. Recent experiments on the laboratory rearing of tropical lobster larvae. Proc. Gulf Carrib. Fish. Inst. 21:152-157.
  • Ptacek, M.B., Sarver, S.K., Childress M.J., and W.F. Herrnkind. 2001. Molecular phylogeny of the spiny lobster genus Panulirus (Decapoda: Palinuridae). Marine and Freshwater Research 52:1037-1047
  • Sarver, S.K., Silberman, J.D., and P.J. Walsh. 1998. Mitochondrial DNA sequence evidence supports the recognition of two subspecies or species of the Florida spiny lobster Panulirus argus. Journal of Crustacean Biology 18(1):177-186
  • Sarver, S.K., D.W. Freshwater, and P.J. Walsh. 2000. The occurrence of the Brazilian sub-species of the spiny lobster (Panulirus argus westonii) in Florida waters. Fishery Bulletin 98:870-873
  • Silberman, J.D. and P.J. Walsh. 1994. Population genetics of the spiny lobster Panulirus argus. Bull. Mar. Sci. 54:1084.
  • Sims, H.W., and R.M. Ingle. 1967. Caribbean recruitment of Florida's spiny lobster population. Q. J. Fla. Acad. Sci. 29:207-242.
  • Sutcliffe, W.H. 1952. Some observations of the breeding and migration of the Bermuda spiny lobster, Panulirus argus. Proc. Gulf Caribb. Fish. Inst. 4:64-69.
  • Sweat, D.E. 1968. Growth and tagging studies on Panulirus argus (Latreille) in the Florida Keys. Fl. St. Brd. Conserv. Mar. Res. Lab. Tech. Pub. No. 57. 30p.
  • Williams, A.B. 1984. Shrimps, Lobsters, and Crabs of the Atlantic Coast of the Eastern United States. Maine to Florida. Smithsonian Institution Press, Washington, D.C. USA. 550p.
  • Warner, R.E., C.L. Combs, and D.R. Gregory. 1977. Biological studies of the spiny lobster. Panulirus argus (Decapoda: Palinuridae) in south Florida. Proc. Gulf Caribb. Fish. Inst. 29:166-183.
  • Witham, R. 1974. Preliminary thermal studies on young Panulirus argus. Q. J. Fla. Acad. Sci. 36:154-158.
  • Witham, R., R.M. Ingle, and E.A. Joyce Jr 1968. Physiological and ecological studies of Panulirus argus from the St. Lucie estuary. Fla. Brd. Conserv. Mar. Res. Lab. Tech. Ser. No. 3. 31 p.
  • Witham, R., R.M. Ingle, and H.W. Sims, Jr. 1964. Notes on postlarvae of Panulirus argus. Q. J. Fla. Acad. Sci. 27:289-297.
  • Wynne, D. 1979. Low temperature limits on behavior of spiny lobster, Panulirus argus (Crustacea: Palinuridae). M.S. Thesis. Florida State University, Tallahassee.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

The Caribbean Spiny Lobster (Panulirus argus) is the most important commercial palinurid in American waters. It is fished practically throughout its range. The catches of this species reported in the FAO Yearbook of Fisheries Statistics amounted to 32,854 metric tons in 1987 and 33,903 metric tons in 1988, with most of the catch taken by Cuba, Brazil, Bahamas, the U.S.A, and Honduras. The species is mostly caught with traps, but is also taken by hand, speared, and trawled. It is marketed fresh; the tails are exported frozen or canned. (Holthuis 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Panulirus argus

Panulirus argus, the Caribbean spiny lobster,[2] is a species of spiny lobster that lives on reefs and in mangrove swamps in the western Atlantic Ocean.

Anatomy[edit]

P. argus have long, cylindrical bodies covered with spines. Two large spines form forward-pointing "horns" above the eyestalks. They are generally olive greenish or brown, but can be tan to mahogany. There is a scattering of yellowish to cream-colored spots on the carapace and larger (usually four to six) yellow to cream-colored spots on the abdomen. They have no claws (pincers). The first pair of antennae are slender, black or dark brown and biramous. The second pair of antennae are longer than the body, and covered with forward pointing spines. The bases of the second antennae are thick, can have a bluish tinge, and are likewise covered with rows of spines. The legs are usually striped longitudinally with blue and yellow and terminate in a single spine-like point. The somites of the abdomen are smooth and have a shallow furrow across the middle. Each has pairs of swimmerets on the underside that are yellow and black. The lobes of the tail are colored similarly to the swimmerets.

P. argus may reach up to 60 cm (24 in) long, but typically around 20 cm (7.9 in), and is fished throughout its range.[2] Sexual maturity in females is reached at a carapace length of 54–80 mm (2.1–3.1 in).[3]

Biology[edit]

Four spiny lobsters off the Florida coast

Like most decapods, P. argus hatches from eggs carried externally by the female for around four weeks.[3] They begin life as a free-swimming, microscopic phyllosoma larvae. After about one year,the larvae settle in algae (Laurencia sp., Neogoniolithon sp.),[4] in Thalassia testudinum seagrass beds or among mangrove roots. After undergoing several molts, they migrate to the coral reefs and live in holes or crevices.[3] As they grow, they molt or shed their exoskeleton to make room for their larger bodies. As in other decapods, after molting, the new exoskleton or shell is soft, and has to harden. During this time, the lobster is highly vulnerable to predation and as a result they are usually very retiring until the new exoskleton hardens fully. The diet is mostly composed of mollusks,[3] but they also consume detritus, vegetable material, and dead animals and fish they find on the bottom.

P. argus is a nocturnal species, taking to cover during the day. They serve as prey for skates, nurse sharks, octopuses, snappers and groupers.[3] Although they generally prefer to remain near cover, at times groups of hundreds will line up and march across the floor off Florida and the Bahamas.[3] The purpose of these migrations is not known, but they generally occur in the fall and may be in response to the onset of autumn storms.[3]

Habitat[edit]

Individuals can be found at depths of up to 100 m (330 ft) from Rio de Janeiro, Brazil to Beaufort, North Carolina,[3] including the Caribbean Sea, the Bahamas and Bermuda,[3] with occasional reports from West Africa.[2] Although they range throughout the entire Gulf of Mexico, in the northern portions of the Gulf they generally are only found at depths of 33 m (108 ft) and greater due to the seasonal variation in the water temperature. Around the southern portion of the Florida peninsula and throughout the Bahamas and Caribbean, they are found in shallower water. They generally prefer habitat with some sort of cover and can be found around coral reefs, artificial reefs, sponges, bridge pilings, wooden bridge bumpers, piers, and under the prop roots of mangroves.

Human consumption[edit]

P. argus is a popular seafood item for human consumption.[2] It is the most important food export of the Bahamas, and rivals the shrimp industry in the Florida Keys in commercial value. They are eagerly sought by both commercial lobstermen and sport divers in South Florida, the Caribbean, the Bahamas, and Bermuda.

In Florida, there is a season where the spiny lobster may be taken, usually from the beginning of August to the end of March, to protect the species during its main breeding season. A special "mini season" a few days before the start of the regular lobster season gives recreational divers a "head start" in catching them. Divers catch them by gloved hand, often "tickling" them out of their dens with a dowel or small stick. In the Bahamas and Caribbean, they are often also speared or gigged (Florida game regulations prohibit taking them by these methods). In Bermuda, licensed individuals can only take lobsters by free-diving and using an approved noose within designated areas; all other methods and use of air tanks are prohibited. Commercial fisherman typically use lobster traps similar to those used by lobster fishermen in New England. The traps are usually baited with dead fish or chicken necks.

Lobsters can be cooked in many ways, a popular method in the Caribbean is to grill the lobster after splitting and seasoning.

Common names[edit]

Other common names for the species in the United States include spiny lobster, Bermuda spiny lobster, common spiny lobster, crawfish, Florida spiny lobster, West Indian langouste and West Indian spiny lobster.[2]

References[edit]

  1. ^ M. Butler, A. Cockcroft, A. MacDiarmid & R. Wahle (2011). "Panulirus argus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved June 5, 2013. 
  2. ^ a b c d e f Lipke B. Holthuis (1991). "Panulirus argus". FAO Species Catalogue, Volume 13. Marine Lobsters of the World. FAO Fisheries Synopsis No. 125. Food and Agriculture Organization. pp. 133–134. ISBN 92-5-103027-8. 
  3. ^ a b c d e f g h i J. L. Munro (1983). "The biology, ecology and bionomics of spiny lobsters (Palinuridae), apider crabs (Majidae) and other crustacean resources". In J. L. Munro. Caribbean Coral Reef Fishery Resources. ICLARM Technical Reports 7 (2nd ed.). The WorldFish Center. pp. 206–222. ISBN 978-971-10-2201-3. 
  4. ^ Bos AR, S Clark and S Gore (2003). Preliminary observations on habitat use of juvenile Caribbean spiny lobster (Panulirus argus) in South Caicos, Turks & Caicos Islands. Proceedings of the 54th Annual Meeting of the Gulf and Caribbean Fisheries Institute. pp. 230–240. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!