Overview

Distribution

Range Description

This species is known throughout the Indian Ocean (east coast of Africa and the Red Sea) east to Japan, Micronesia, Melanesia, Polynesia, and Northern Australia (Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical Indo-Pacific, also distributed in Australia in Kalk (1958).
  • Fischer, W. & G. Bianchi (Eds.) (1984). FAO Species identification sheets For Fisheries Purposes: Western Indian Ocean. FAO, Rome.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in areas of coral reef, most often on the seaward edge of reef plateaus, where it utilizes the reef and rocks for shelter. It is found in shallow waters, to a maximum depth of 15 m (Holthuis 1991). Furthermore, they are nocturnal and they only aggregate in very small numbers (Frisch 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 1 - 900
  Temperature range (°C): 5.058 - 28.954
  Nitrate (umol/L): 0.048 - 32.409
  Salinity (PPS): 34.131 - 34.960
  Oxygen (ml/l): 1.842 - 4.664
  Phosphate (umol/l): 0.113 - 2.744
  Silicate (umol/l): 1.557 - 112.476

Graphical representation

Depth range (m): 1 - 900

Temperature range (°C): 5.058 - 28.954

Nitrate (umol/L): 0.048 - 32.409

Salinity (PPS): 34.131 - 34.960

Oxygen (ml/l): 1.842 - 4.664

Phosphate (umol/l): 0.113 - 2.744

Silicate (umol/l): 1.557 - 112.476
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

in shallow water, from the sublittoral down to 15m depth, in coral reef areas, often on seaward edges of the reef plateau
  • Holthuis, L.B. 1991. FAO species catalogue. Vol 13. Marine lobsters of the world. An annotated and illustrated catalogue of species of interest to fisheries known to date. FAO fisheries Synopsis. 125 (13):292 p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus versicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCGAGCAGAACTGGGACAACCAGGAAGACTAATTGGAGAT---GATCAAATTTACAATGTAGTAGTGACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCTATTATAATTGGTGGATTTGGTAATTGACTTGTTCCAATTATACTAGGTGCTCCAGATATGGCATTTCCCCGAATAAACAACATAAGATTCTGACTCTTACCACCGTCTCTAACACTTCTCCTAGCCAGTGGTATAGTAGAAAGAGGAGTCGGAACTGGTTGAACAGTGTACCCACCTCTTTCGGCCGCGGTAGCCCATGCTGGTGCATCAGTAGATCTTGGTATTTTCTCACTCCACCTAGCCGGTGTATCCTCAATCCTAGGTGCCGTAAACTTTATTACAACAGTAATTAACATACGATCCTCAGGTATAACATTCGACCGAATACCTTTATTCGTATGATCAGTTTTCATTACCGCCATCCTGCTACTCCTATCTCTCCCAGTACTAGCAGGAGCTATTACAATACTCCTTACAGATCGTAACCTGAATACATCATTCTTTGATCCAGTAGGCGGAGGAGACCCCATTCTATATCAGCATTTATTTTGATTCTTCGGTCACCCGGAAGTTTATATTCTTATTCTTCCAGCATTCGGTATAATTTCTCATATCGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus versicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Cockcroft, A., Butler, M. & MacDiarmid, A.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification
Panulirus versicolor has been assessed as Least Concern. This species has a wide distribution and faces no immediate threat of extinction from harvesting for food. Fisheries typically operate on a small scale but there is no indication that the global stock is in decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a common species. It is harvested throughout its range, but is mostly for local use (Holthuis 1991). It is harvested by artisanal, recreational and commercial fishers predominantly within Kenya, India, Palau, New Guinea, and the Great Barrier Reef in Australia. Global catches are comparatively low compared to other Palinurid species at approximately 1,000 to 8,000 kg year-1 per country (MacDonald 1982, Kailola et al. 1993). In India this species only comprises a very small proportion of the palinurid catch (Radhakrishnan et al. 2005) and is exploited at low to moderate levels (Vijayakumaran and Radhakrishnan 1997). Commercial catches of this species were sampled from 1969 to 1970 in Palau. Results indicated that the population had undergone very little fishing pressure, and both sexes were equally abundant. Recruitment appears to occur all year round (MacDonald 1982). In a study of Palinurid catch composition from Sri Lanka, this species comprised only 3% of the total catch (Jayawickrema 1991).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species may be experiencing localized declines due to fishing, but this is not believed to impacting upon the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Management strategies for this species are few; any existing strategies are based on precautionary principles (Frisch 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Panulirus versicolor

Panulirus versicolor is a species of spiny lobster that lives in tropical reefs. Other names include painted rock lobster, common rock lobster, bamboo lobster, blue lobster, and blue spiny lobster. P. versicolor is one of the three most common varieties of spiny lobster in Sri Lanka, alongside Panulirus homarus and Panulirus ornatus.[2]

Morphology[edit]

P. versicolor grows up to 40 centimetres (16 in) long, but is typically no more than 30 cm (12 in).[3] It has no claws, two spiny rostra over the eyes, and two pairs of large antennae, like all spiny lobsters. The first pair of antennae are double ended, the second hard and spiny, both are usually white. The carapace is white, pink and black, with horizontal bands and a reticule. The abdomen is green with transverse black and white bands. The legs are dark brown with white stripes and the tail is blue-green.

Behaviour[edit]

P. versicolor is nocturnal and solitary.[3] In the daytime they hide in small caves and crevices in reefs or under coral at depths up to 15 metres (49 ft).[3] They are carnivores, eating both carrion and fresh caught arthropods, other crustaceans, and occasional small fish.

Geographic distribution[edit]

P. versicolor occurs in the shallow tropical waters of the western Pacific and the Indian Ocean. In the Indian Ocean it occurs from as far south on the east coast of Africa as Natal, up through the Red Sea and Persian Gulf, in the Arabian Sea across to India, Myanmar, Thailand, and Malaysia, down through Indonesia to the waters of north-western Australia. In the western Pacific it occurs as far north as southern Japan, throughout Micronesia, Melanesia, Polynesia and in the waters of north-eastern Australia.

Economic uses[edit]

Panulirus versicolor is used as a food source throughout its range.[3] P. versicolor is also kept in home aquariums.[4][5]

References[edit]

  1. ^ A. Cockcroft , M. Butler & A. MacDiarmid (2009). "Panulirus versicolor". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved August 22, 2011. 
  2. ^ George H. de Bruin, Barry C. Russell & André Bogusch, ed. (1995). "Lobsters: Palinuridae". The Marine Fishery Resources of Sri Lanka. Rome: Food and Agriculture Organization. ISBN 92-5-103293-9. 
  3. ^ a b c d Lipke B. Holthuis (1991). "Panulirus versicolor". FAO Species Catalogue, Volume 13. Marine Lobsters of the World. FAO Fisheries Synopsis No. 125. Food and Agriculture Organization. pp. 156–157. ISBN 92-5-103027-8. 
  4. ^ "Blue Lobster" Pet Solutions
  5. ^ "Farmed aquarium products from Solomon Islands: creating new rural livelihoods from sustainable culture of ornamentals" World Wildlife Fund
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!