Overview

Distribution

Range Description

This species is only known from Hawaii, including the Northwest Hawaiian Islands (Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

FAO fishing area 77, Hawaii, Hawaiian Islands, South Sandwich Islands
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
"Shallow water" under rocks and crevices on rocky bottoms, according to Holthuis (1991), although it has been recorded as deep as 143 m. This species is nocturnal. Although longevity and age at maturity are not known for this species, inference from similar species (e.g., the Caribbean Spiny Lobster Panulirus argus) suggests a longevity of up to 20 years and sexual maturity at around four years.

Changes in recruitment levels for this species are related to Pacific sea levels four years earlier (Polovina and Mitchum 1992).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 5.5 - 7
  Temperature range (°C): 23.113 - 24.451
  Nitrate (umol/L): 0.062 - 0.133
  Salinity (PPS): 35.143 - 35.289
  Oxygen (ml/l): 4.817 - 4.961
  Phosphate (umol/l): 0.075 - 0.097
  Silicate (umol/l): 1.278 - 2.719

Graphical representation

Depth range (m): 5.5 - 7

Temperature range (°C): 23.113 - 24.451

Nitrate (umol/L): 0.062 - 0.133

Salinity (PPS): 35.143 - 35.289

Oxygen (ml/l): 4.817 - 4.961

Phosphate (umol/l): 0.075 - 0.097

Silicate (umol/l): 1.278 - 2.719
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus marginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCATGAGCAGGGATAGTAGGAACTTCTCTAAGACTTATTATTCGAGCCGAACTAGGTCAACCGGGTAGTTTTATTGGAGAC---GACCAGATTTACAATGTAGTAGTAACCGCTCACGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAATTCCTATTATATTAGGAGCTCCTGATATAGCCTTTCCTCGGATGAATAACATAAGATTTTGACTTCTTCCTCCATCCCTAACTCTCTTACTAGCTGGAGGTGCAGTCGAAAGAGGTGCAGGTACTGGTTGAACAGTTTACCCTCCCTTANCGGCTGGTGTAGCGCACGCAGGAGCGTCAGTAGACCTAAGAATCTTCTCCCTTCACCTAGCAGGTGTTTCATCCATTTTAGGTGCCGTTAATTTCATTACTACAGTAATCAACATGCGTTCTTCCGGTATAACCCTTGATCGAATGCCAATTTTTGTGTGGTCAGTTTTTATTACAGCCATGTTACTTTTCTTATCTCTGCCCGTTTTAGCTGGAGCTATTACTATACTTCTTACCGATCGAAATTTAAATACTTCCTTTTTTGATCCAGTCGGAGGCGGAGATCCAATTCTCTACCAACATTTATTTTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus marginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Butler, M., Cockcroft, A. & MacDiarmid, A.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, HT, Soulsby, A.-M. & Whitton, F.

Justification

Panulirus marginatus has been assessed as Data Deficient. This species has, in the past, experienced threat from over-harvesting throughout its range, where declines of over 80% in catch per unit effort data have been recorded (mid 1970s to 1999) from the NWHI fishery. This would have made the species eligible for Endangered classification (A1abd). However, since 2000 harvesting of this species has ceased as the fishery was closed and a marine protected area designated, with ongoing management and monitoring by the National Marine Fisheries Service, Honolulu Laboratory. Currently there are no accurate abundance data for this species and therefore the population trend since 2000 is unknown. Once this data is available a more accurate assessment of this species can be carried out, which may result in a Least Concern classification.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the past there were striking contrasts in abundance between different Hawaiian islands; e.g., Maro Reef adjusted landings were more than 300 times those from Lisianski Island, despite both being of similar size and depth and only 330 km apart (Parrish and Polovina 1994). This suggests a highly heterogeneous population structure for this species, determined partly by habitat topography. Generally catches were lowest on banks with summits deeper than 30 m (Parrish and Polovina 1994).

In Hawaii, there has been a commercial lobster fishery in operation in the Northwestern Hawaiian Islands (NWHI) since the mid-to late 1970s - with a one year closure in 1993 - primarily targeting this species and the Blunt Slipper Lobster (Scyllarides squammosus) (Pooley and Kawamoto 1998). Catches showed large year-to-year fluctuations, but despite this, it is Hawaii's most valuable demersal fishery (Parrish and Polovina 1994). Two banks: Necker Island and Maro Reef, were the focus of especially high fishing effort after 1980, with subsequent declines in catch per unit effort (CPUE: 37 and 68 % respectively of 1977 and 1987 levels). There was also a significant shift towards decreasing carapace length in the same period (Polovina 1989).

Fivefold declines in CPUE were observed at Necker Bank through the late 1980s and 1990s, both for commercial catch-per-trap haul and in research landings of all size groups (including juveniles) (DeMartini et al. 2003). This occurred simultaneously with increasing size-specific fecundity, a compensatory response consistent with decreases in median body size at sexual maturity (DeMartini et al. 2003). The result of this was that egg production was dominated by smaller females, partly due to the poor representation of large females in the population (DeMartini et al. 2003).

As landings of all species were showing declines, in 2000 the NWHI fishery was closed as a precautionary measure due to increasing uncertainty of the population models used to assess stock status. Later on that year the Northwestern Hawaiian Islands Coral Reef Ecosystem Reserve was established which may prohibit commercial lobster fishing in the NWHI indefinitely (DiNardo and Moffitt 2007). For catch data from the NWHI fishery whilst it was in operation see DiNardo and Moffitt (2007).

CPUE data for this species from 1983 (mature lobster landings/trap hauls; data from DiNardo and Marshall 2001):
1983 - 2.47; 1984 - 1.83; 1985 - 0.96; 1986 - 0.65; 1987 - 0.49; 1988 - 1.06; 1989 - 0.88; 1990 - 0.50; 1991 - 0.44; 1992 - 0.36; 1993 - closed; 1994 - 0.51; 1995 - 0.55 (experimental fishery); 1996 - 1.07; 1997 - 0.79; 1998 - 0.40; 1999 - 0.31; 2000 - fishery closed.

This suggests an approximately 87 % decline in CPUE between 1983 and 1999 across the NWHI fishery. Surveys at Necker Island showed a drop in CPUE of 80 % between 1988 and 1999, with that of 2-year old lobsters declining by 85 % over the same period, suggesting recruitment to the fishery is also suffering. Data from other Hawaiian islands (e.g., Laysan Island) also show steep CPUE declines (DiNardo and Marshall 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The NWHI fishery has been closed since 2000 and a protected area now covers this species' distribution, therefore there are no current threats impacting this species. Previous declines in catch per unit effort (CPUE) of over 80 % have been recorded for this species between 1983 and 1999 (DiNardo and Marshall 2001), which had knock-on effects in relation to fecundity (DeMartini et al. 2003), but there is no information to indicate this has had a long-term impact on the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The fishery for this species was closed in 2000, upon the creation of the Northwest Hawaiian Islands Coral Reef Ecosystem Reserve. Were it to re-open in the future - which is conditional on the recovery of lobster populations - several management practices should be put in place. The first of these is a minimum size limit, as past "retain all" policies, introduced in 1996 to reduce discard, were detrimental to populations of this species. DeMartini et al. (2003) recommend a larger limit than the previous 50 mm used until 1996, in order to protect smaller females which are now the primary egg-producers. This may help to counter recruitment overfishing (DeMartini et al. 2003).

Necker Island is an important focus for stock recovery efforts, as it is thought to be an important source of larvae for the rest of the fishery. This tallies with a novel metapopulation-based approach to the fishery (DiNardo and Marshall 2001), based on the premise that "overfishing or depletion of local populations could
result in catastrophic impacts to the population as a whole (e.g. a reduction in average recruitment or recruitment failure), particularly when a large number of local populations or the most productive populations are overfished". This calls for the collection of higher-quality population data, which is being addressed by the National Marine Fisheries Service, Honolulu Laboratory (NMFS-HL) in the form of a research and monitoring plan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Panulirus marginatus

Panulirus marginatus is a species of spiny lobster in the family Palinuridae which is endemic to the Hawaiian Islands.[2] It is the subject of extensive commercial and recreational fisheries.[2]

References

  1. ^ M. Butler, A. Cockcroft & A. MacDiarmid (2009). "Panulirus marginatus". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved August 22, 2011. 
  2. ^ a b W. Glenn Lyle & Craig D. MacDonald (1983). "Molt stage determination in the Hawaiian spiny lobster Panulirus marginatus". Journal of Crustacean Biology 3 (2): 208–216. JSTOR 1548257. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!