Overview

Comprehensive Description

Morphologie : le céphalothorax (corps) du crabe honteux est relativement volumineux. Adulte, il atteint des dimensions maximales de 11 cm de largeur, pour 8 cm de longueur. Les principales caractéristiques de la carapace sont : quatre sillons longitudinaux sur les parties latérales concaves, plus prononcés sur l’avant, puis sur les parties latérales antérieures, deux extensions aliformes frangées de fortes dents triangulaires. L’espace inter-orbital est très étroit. Les chélipèdes (pinces), sont larges, assez plats et s’imbriquent parfaitement contre la face antérieure ; le profil crénelé de leur bord supérieur épouse parfaitement le bord antérodorsal du céphalothorax. Leur position donne l’impression que le crabe se cache la face, ce qui lui a valu le nom de crabe honteux. Les quatre paires de pattes ambulatoires sont fines, lisses et l’article terminal (dactyle) est une pointe acérée. Le dimorphisme sexuel, habituellement bien prononcé chez les crabes au niveau de l’abdomen (replié sous le thorax), est plus nuancé chez C. granulata, légèrement plus étroit chez le mâle. Chez la femelle uniquement, les segments 3, 4 et 5 sont libres.
La carapace est de couleur rose clair, parfois jaunâtre. Elle est couverte de tubercules plus ou moins alignés, rose foncé ou rougeâtre. Les péréiopodes (pattes) ambulatoires sont jaune clair.

Biologie : le crabe honteux se nourrit de crustacés ou d’autres invertébrés qui partagent son habitat. Ses puissantes pinces lui permettent de venir à bout de coquilles de gastéropodes, bivalves… Son activité est essentiellement nocturne. Sa période de reproduction s’étale de juillet à septembre sur les côtes espagnoles, période qui peut varier en d’autres régions et suivant les variations climatiques.

Ecologie & distribution : C. granulata vit sur les fonds meubles sablo-vaseux et détritiques du plateau continental, jusqu’à 400 mètres de profondeur. Il est possible de l'observer exceptionnellement en plongée à partir de 15-20 mètres en exploration nocturne. Le jour, il reste enfoui dans le substrat et reste inactif. Cette espèce est présente en Atlantique Est, des côtes mauritaniennes au sud jusqu’au Portugal et même dans le Golfe de Gascogne (rare), et dans toute la Méditerranée (mer d’Alboran, Adriatique, mer Ionienne, mer Egée et mer de Marmara).

Interactions avec les activités humaines : Ce crabe fait l’objet d’une pêche artisanale localisée et se trouve également parmi les prises accidentelles de la pêche semi-industielle. Il est couramment présent sur les marchés espagnols, marocains et sur les rivages de la mer Ligure ; il est plus rare ailleurs. Certains aquariums publics présentent occasionellement cette espèce.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calappa granulata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTACATTATATTTTATTTTTGGGGCTTGATCTGGGATAGTTGGGACTTCTTTAAGTCTTATTATTCGAGCTGAGCTAGGCCAGCCGGGGACATTGATTGGTAATGATCAAATTTATAACGTTGTCGTTACCGCCCATGCCTTCGTTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTCGGAAATTGACTTATTCCTCTTATGTTAGGAGCACCTGATATAGCATTCCCTCGTATAAATAATATAAGATTCTGACTCTTACCTCCCTCTCTCACTTTACTACTTATAAGAGGAATAGTAGAAAGAGGTGTAGGTACTGGATGAACCGTTTACCCGCCTCTAGCCGCAGCTATTGCCCATGCAGGAGCTTCCGTTGATATGGGAATTTTCTCACTCCATCTTGCTGGGGTATCTTCGATCTTAGGAGCCGTTAACTTTATAACAACCGTAATTAACATACGATCCTACGGAATACTTATAGACCAAATACCTTTATTTGTATGAGCAGTGTTTATTACTGCTATCCTACTATTACTATCGTTACCAGTCTTGGCAGGGGCTATCACTATGCTATTAACAGATCGTAATTTAAACACCTCCTTTTTCGACCCTGCAGGAGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calappa granulata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!