Overview

Comprehensive Description

Biology

Adults occur in standing to slow-flowing water, mostly in vegetated ponds and lakes, backwaters and quiet pools of steams (Ref. 5723), typically seen shoaling at the edges (Ref. 44894). They also frequent brackish water (Ref. 5723). Adults feed on small terrestrial insects usually in the drift and amongst aquatic plants, actively selecting very small prey (Ref. 6154). Also observed to take in mosquito larvae (Ref. 41168). Introduced worldwide. Introductions to Europe have seriously threatened many endemic species (Ref. 59043). It is now widely accepted that their effect has been minimal and even may have exacerbated the problem due to their voracious appetite for natural invertebrate predators of mosquito larvae (Ref. 44894).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gambusia holbrooki ZBK Girard, 1859

Inland water: 26500-614 (2 spc.), 26.05.1978 , Mert Lagoon , Kirklareli , hand scoop , N. Meriç ; 26500-847 (3 spc.), 22.07.1990 , Bakirkoey , Istanbul , Zeki Güçlü ; 26500-848 (19 spc.), 22.07.1990 , Bakirkoey , Istanbul , Zeki Güçlü .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 40-40, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Range includes the Atlantic and Gulf slope drainages from southern New Jersey to the Pascagoula River and nearby streams, southeastern Mississippi; absent from the Mobile Bay drainage except the extreme southern part (Page and Burr 2011). This species has been introduced outside the native range; it may be established in some of these areas.

See Walters and Freeman (2000) for information on the distribution of G. affinis and G. holbrooki in the Conasauga River system, where affinis is widespread and native and holbrooki is apparently introduced and expanding its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range includes the Atlantic and Gulf slope drainages from southern New Jersey to the Pascagoula River and nearby streams, southeastern Mississippi; absent from the Mobile Bay drainage except the extreme southern part (Page and Burr 2011). This species has been introduced outside the native range; it may be established in some of these areas.

See Walters and Freeman (2000) for information on the distribution of G. affinis and G. holbrooki in the Conasauga River system, where affinis is widespread and native and holbrooki is apparently introduced and expanding its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic and Gulf Slope drainages from New Jersey south to Alabama in USA (Ref. 5723). Introduced to many countries for mosquito control, but had rare to non-existing effects on mosquitoes, and negative to perhaps neutral impact on native fishes (Ref. 12217). Established throughout southern Europe; introduced worldwide in tropical and subtropical countries (Ref. 59043).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 7; Analspines: 1; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

3.5 cm TL (male/unsexed; (Ref. 1672)); 8 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Gambusia holbrooki
Catalog Number: USNM 8301
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Girard
Locality: Charleston, S.C., South Carolina, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species often occurs in shallow, often stagnant, ponds and shallow edges of lakes and streams where predatory fishes are largely absent and temperatures are high. It also can be found in brackish sloughs and coastal saltwater habitats.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species often occurs in shallow, often stagnant, ponds and shallow edges of lakes and streams where predatory fishes are largely absent and temperatures are high. It also can be found in brackish sloughs and coastal saltwater habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; brackish; pH range: 6.0 - 8.8; dH range: 40
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds mainly on insects (Ref. 6154).
  • Arthington, A.H. 1989 Diet of Gambusia affinis holbrooki, Xiphophorus helleri, X. maculatus, and Poecilia reticulata (Pisces: Poeciliidae) in streams of southeastern Queensland, Australia. Asian Fish. Sci. 2:193-212. (Ref. 6154)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Opportunistic omnivore; eats mainly small invertebrates (e.g., zooplankton, insect larvae), often taken near water surface. Also eats small fishes (e.g., small least killifishes) and, in absence of abundant animal food, probably also algae and diatoms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species is common in much of its range, locally abundant in some areas (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Matures at 4-6 weeks; 3 generations can be produced in one year. Gestation lasts 3-4 weeks. Brood may reach up to 354 young, but is generally around 40-60 (Ref. 1672, 59043).
  • Wischnath, L. 1993 Atlas of livebearers of the world. T.F.H. Publications, Inc., United States of America. 336 p. (Ref. 26130)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds in spring and summer. Internal fertilization; ovoviviparous. Female produces up to several broods of young each season. Under optimal conditions females can become gravid at 6 weeks of age, produce 2-3 broods in first summer. Gestation 3-4 weeks. Few individuals live more than 15 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gambusia holbrooki

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTACTATTTGGTGCTTGAGCTGGCATAGTTGGAACAGCTCTGAGCCTACTGATCCGGGCCGAACTCAGTCAGCCAGGCACACTTCTTGGAGACGACCAGATCTACAATGTAATCGTTACAGCTCATGCTTTTGTAATAATCTTTTTTATAGTTATACCCATCATAATTGGAGGGTTTGGTAACTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCCTTTCCACGAATAAACAACATAAGCTTTTGATTACTTCCCCCCTCATTTCTCCTCCTCCTCGCATCTTCTGGGGTTGAAGCAGGGGCAGGAACAGGCTGAACTGTCTATCCCCCTCTTGCAGGTAACCTAGCACATGCCGGACCTTCTGTAGACCTAACCATCTTTTCCCTTCACCTAGCGGGCATCTCCTCTATTCTGGGAGCTATCAATTTTATTACCACCATTATTAATATAAAACCTCCCGCAGCCTCCCAGTACCAAACACCATTGTTTGTATGGGCAGTCCTAATTACAGCTGTACTCCTCCTTCTTTCCCTTCCAGTTCTTGCCGCAGGTATTACTATACTTCTTACAGATCGAAACCTAAACACCACTTTCTTTGATCCAGCGGGGGGCGGAGACCCAATCCTCTATCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gambusia holbrooki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large. This species is common in much of its range, locally abundant in some areas (Page and Burr 2011).

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eastern mosquitofish

Eastern mosquitofish in a pond in the Pee Dee region of South Carolina, 2011

The eastern mosquitofish, Gambusia holbrooki, is a species of freshwater fish, closely related to the western mosquitofish, Gambusia affinis.[2][3][4] It is a member of the family Poeciliidae of order Cyprinodontiformes. The western mosquitofish has a larger distribution throughout the United States, while the eastern mosquitofish is native to eastern and southern United States spanning from Florida to Delaware and as far interior as Alabama and Tennessee.[5][6]

Description[edit]

G. holbrooki is a small, light colored fish with semi-transparent fins. The females usually have a black stripe near their eye area and light spots can be seen on the caudal and dorsal fins of both sexes.[7] Due to its similar size, shape and reproductive habits, it can easily be mistaken for a guppy.[8] Generally, males reach 1.5 in (3.8 cm) and females 2.5 in (6.4 cm). These fish are a live bearer species and as such the females are larger and more rounded then the males. Pregnant females are also easily recognizable by their gravid spot; a darker area on their bellies where they hold the fry.

Diet[edit]

G. holbrooki is considered a planktivorous species which consumes algae and detritus to enhance its dietary requirements. Feeding habits seem to change based on maturity and mating season.[9][10]Gambusia holbrooki is a planktivorous species that will, if need arises, switch food sources to survive. With an increase of competition, this species will switch from a diet rich in plankton, algae, and detritus to one consisting of zooplankton, other invertebrates, the larvae of many species, and plant-associated animals.[9] The main source of competition for G. holbrooki seems to be an increase of its own species and other planktivorous species. The main problem with this is, as mentioned before, it will change its diet; this is common even among the juveniles and both sexes of its own species. The females tend to not specialize on one prey, and consume all evenly, whereas the males and juveniles specialize on one prey type. However. males, females, and juveniles all consume detritus at the same rate.[11]

Habitat[edit]

Gambusia holbrooki is found in the southeastern United States and has become an invasive species in Australia, where they were released as a method to decrease mosquito populations. This species thrives in shallow water between 31 and 35°C, and seems to be able to acclimate to temperatures above and below this. G. holbrooki has been shown to survive in water with pH and chemical levels known to kill other fish species, and prefers to live in areas where the water flows at a slow pace, is clear and without free-floating plant life, and seeks shelter in rooted plants.Gambusia holbrooki is native to the southeastern United States, and can be found in many of the lakes within that area, which includes lakes east of the Mississippi River. No decrease in this species due to human activities has been noted.[11] G. holbrooki is easily maintained and has never been considered an endangered or threatened species due to its ability to thrive in its native habitat.[1] Due to releases in new areas, G. holbrooki has actually increased its range. It tolerates chemical and temporal changes quite easily, and this might be one reason they have not shown a decrease in population due to environmental changes caused by humans.[11][12]

Reproduction[edit]

Temperature has been shown to change the length of time it takes them to reach reproductive maturity and body size. This species is also known to give birth to live young instead of laying a clutch of eggs.[11][12] The breeding season for Gambusia holbrooki is between midspring and midautumn, with the peak breeding time being around summer. Females can have up to nine broods per mating season, with the average size ranging from five to 100.[11] The variability of the average brood size is due to many variables, including temperature, age, and available nutrients. Higher temperatures have been shown to increase the fecundity of this species.[12] The gestation period for this species is between 22 and 25 days.

Growth[edit]

The offspring juvenile stage lasts between 18 days and eight weeks. Once again, changes in temperature affects these numbers; colder temperatures decrease and higher temperatures can increase maturity. This species can have several generations within their breeding period due to the fast rate of growth. The usual life span is between one and two years, as determined by stress factors in their habitats.[11][12] Sexual selection in this species is based on the size of the male. Females tend to choose larger, more aggressive males. Females tend to choose areas of shallow water with dark soil cover for brooding sites, while juveniles prefer more rooted plants in which to hide.[10] The main human-induced change that affects the growth rate and life history of G. holbrooki is the water temperature, which, as stated before, can increase or decrease both the growth rates and birth rates.

Environmental impact[edit]

Since G. holbrooki is not considered endangered or threatened, no true management plan is in effect for this species within the United States. In fact, this fish is considered an invasive species in Australia, due to its ability to thrive in many different environmental conditions which are usually lethal to other fish species.[1] The main recommendation for this species is to find a way to decrease their numbers in areas where they are considered an invasive species. In Australia, they have been introduced as a means to control the mosquito population.[11] However, they have become an invasive species that causes harm to native species which have an aquatic larval stage. Australia has set up conservation management plans to try to save native species from Gambusia holbrooki. One such management plan included releasing a chemical known to kill mosquito larvae. The chemicals used were found to have a strong effect on the G. holbrooki, but they became tolerant to most of them fairly rapidly unless amounts considered unsafe for native species were used. Another tried and failed attempt to decrease this invasive species was electrifying a lake known to have been invaded. The cost and loss of native fish was so great, this method was dropped. The main reason it failed was these fish stay in the shallows, which receive the smallest charge from the electrification method used. Later tests also revealed this species has a high tolerance for electrical shock, but the exact mechanism that allows this still seems to be questionable.[11] Eastern mosquitofish were introduced to control mosquitoes, when in reality various small Australian native fish were already keeping mosquitoes to a minimal level.[citation needed] They are aggressive, fin-nipping harassers of other fish, and pose a serious threat to native Australian fish and aquatic fauna. Negative impacts on rainbowfish species and at least one frog species have been documented. Several rainbowfish populations appear to have become extinct due to the impacts of introduced Gambusia.

Population eradication[edit]

The management recommendation for this species would be for the areas where Gambusia holbrooki is considered invasive, since there is no known need to have a conservation management plan set up to protect this species in its native area. This, of course, is due to its ability to grow and reproduce at a fast rate, and the ease of raising a population under controlled supervision.[9][12] Using population density would be the best way to keep track of the population in the areas where it is considered invasive; since it is not native, the population should be zero in these areas. A minnow seine would be the best type of equipment to use when measuring the population density, due to their small size. Samples for this species would have to be taken in the shallows of lakes where the water is slow, has little floating vegetation, and has rooted plants, where they thrive and have become an invasive species . Sampling frequency would be based on the overall growth and spread of this species. In areas known to be heavily populated, more frequent sampling would have to be taken to know how fast the population is increasing, which allows for better control by a concentrated attack during periods of lower population density. It seems the only safe route to remove this invasive species is by catching the adults with a net and using one of the poisons known to kill this species. Most of the young should be killed by the poison, with the adults being physically removed. This method could cause a decrease within the population, and if kept up, could eradicate them from the introduced areas.

Predators[edit]

Little research has been done to determine all G. holbrooki predators, due to its own predatory nature in the areas where it has been introduced. In the introduced areas, it has been known to cause top-down trophic effects due to its eating the larvae of some top predators, which include frogs and other fish.[9]

References[edit]

  1. ^ a b c Hernandez-Martich, J. D., and M. H. Smith. 1997. Downstream gene flow and genetic structure of Gambusia holbrooki (eastern mosquitofish) populations. Heredity 79: 295-301.
  2. ^ Wooten et al. 1988
  3. ^ Rauchenberger 1989
  4. ^ Robins et al. 1991
  5. ^ http://nas.er.usgs.gov/queries/FactSheet.aspx?speciesID=849
  6. ^ Page and Burr 1991
  7. ^ http://www.fcps.edu/islandcreekes/ecology/eastern_mosquitofish.htm
  8. ^ http://www.dpi.nsw.gov.au/fisheries/pests-diseases/freshwater-pests/species/gambusia
  9. ^ a b c d Blanco, S., S. Romo, and M. J. Villena. 2004. Experimental study on the diet of mosquitofish (Gambusia holbrooki) under different ecological conditions in a shallow lake. International Review of Hydrobiology 89: 250-262.
  10. ^ a b McPeek, M. A. 1992. Mechanisms of sexual selection operating on body size in the mosquitofish (Gambusia holbrooki). Behavioral Ecology 3: 1-12.
  11. ^ a b c d e f g h Pyke, G. H. 2005. A review of the biology of Gambusia affinis and G. holbrooki. Reviews in Fish Biology and Fisheries. 15: 339-365.
  12. ^ a b c d e Mulvey, M., G. P. Keller, and G. K. Meffe. 1994. Single and multiple locus genotypes and life-history responses of Gambusia holbrooki reared at two temperatures. Evolution. 46: 1810-1819.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly regarded as a subspecies of GAMBUSIA AFFINIS; elevated to full species status by Wooten et al. (1988); this change was adopted in the 1991 AFS checklist (Robins et al. 1991). Page and Burr (1991) retained HOLBROOKI as a subspecies of AFFINIS, noting intergradation in the Mobile Bay basin. Apparently hybridizes/intergrades with G. AFFINIS in some sites in the Chattahoochee and Savannah river drainages (Lydeard and Wooten 1991). In three drainages in Georgia, South Carolina, and North Carolina, most of genetic divergence occurred among local populations and not among populations from different geographic regions or environments; the 2 forms proposed by Wooten et al. (1988) were not detected in genetic analysis by Hernandez-Matich and Smith (1990). Subgenus ARTHROPHALLUS, AFFINIS species group (Rauchenberger 1989). See Rauchenberger (1989) for a study of the interrelationships of the subgenera and species groups within the genus GAMBUSIA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!