You are viewing this Species as classified by:

Overview

Comprehensive Description

Biology

Usually found on or near bottom in kelp beds or rocky areas (Ref. 2850). Viviparous, with planktonic larvae (Ref. 36715).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Pacific: Timber Cove, Sonoma County in central California, USA to central Baja California, Mexico.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 6 - 7; Vertebrae: 26
  • Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 420 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

42.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 20 years (Ref. 39277)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • Reilly, P.N., D. Wilson-Vandenberg, R.N. Lea, C. Wilson and M. Sullivan 1994 Recreational angler's guide to the common nearshore fishes of northern and central California. Calif. Dept. Fish. Game, Marine Resources Leaflet. (Ref. 39277)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 7 (Ref. 36715).
  • Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 25054
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island Los Angeles County, California, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island Los Angeles County, California, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26870
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24994
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Wilmington, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 46 m (Ref. 2850), usually 9 - 12 m (Ref. 2850)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 46m.
Recorded at 46 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Stomachs were more likely to be empty during the day than at night, suggesting that it is a nocturnal feeder in southern California (Ref. 28090).
  • Hallacher, L.E. and D.A. Roberts 1985 Differential utilization of space and food by the inshore rockfishes (Scorpaenidae: Sabastes) of Carmel Bay, California. Environ. Biol. Fish. 12(2):91-110. (Ref. 28090)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
  • Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes atrovirens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTACTACTCGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAACATGAAGCCCCCCGCCATCTCTCAGTACCAAACACCCCTATTTGTGTGAGCTGTACTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTACCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGCATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTTACAGTTGGCATGGACGTAGACACACGTGCCTACTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTAGCCAATTCATCTCTAGATATTGTACTCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes atrovirens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sebastes atrovirens

Sebastes atrovirens is a species of fish in the rockfish family known by the common name kelp rockfish. It is native to the Pacific Ocean along the coast of California in the United States and Baja California in Mexico.[1]

This species reaches about 42 centimeters in length. Its life span is up to 15[2] to 20[1] or even 25 years. Individuals may be tan, brown, green, reddish, blackish, whitish, or brown-mottled. The snout has an "up-turned" look.[3] This species was recently moved from the Sebastes subgenus Mebarus[4] to Pteropodus, which also includes brown, gopher, copper, black-and-yellow, calico, quillback, China, and grass rockfishes.[5]

This marine fish is distributed from Sonoma County, California, south to central Baja California. The climate is subtropical. It lives in coastal waters up to 42 meters deep, but usually not more than about 12 meters. Its habitat includes kelp beds and rocky seabeds.[1] It commonly associates with several other species of rockfish in this habitat, but it is more closely associated with the kelp than the others.[3] During the day it often rests on the kelp blades, sometimes upside down.[2] The main kelp species is Macrocystis pyrifera, the giant kelp. Other brown algaes in the habitat can include Pterygophora californica, Cystoseira osmundacea, and species of Desmarestia.[6] It is also known from artificial habitat types, such as oil rigs.[3]

Like some other rockfish, this species can produce an auditory signal in the form of a low-frequency pulsing noise.[7]

The diet of the fish is rich in crustaceans[3] such as the isopod Pentidotea resecata,[6] as well as cephalopods and gastropods,[2] and it is known to prey on juvenile blue rockfish (Sebastes mystinus)[3] and plainfin midshipmen (Porichthys notatus).[6] It does most of its hunting at night.[3] In captivity, larvae have been reared on diets of Brachionus plicatilis, a rotifer, with supplements of copepods and veligers as they develop. The nauplius of the brine shrimp Artemia salina becomes the main food later.[5] Captive adults can be maintained on chopped squid[8] and live prey such as the night smelt (Spirinchus starksi).[6]

Spawning starts in February in the northern part of its range, and in March farther south.[3] A female will mate with multiple males and can store sperm, yielding broods of eggs that have multiple fathers.[8] Like other fish of its genus, this species is viviparous.[1] The gravid female expels her whole brood at once, only during the night.[8] The larva is between 4 and 5 millimeters long at birth. It still has a small bit of yolk or oil on its belly which is absorbed within a few days. It quickly develops its head spines. It has some pigmentation at birth in the form of melanophores and xanthophores and develops more as it grows.[5]

This rockfish is an important prey item for many other animals. The larva is consumed by siphonophores and chaetognaths.[2] The juvenile is food for other fish, such as lingcod, cabezon, and salmon, as well as many birds, pinnipeds, and porpoises. The adult is prey for sharks, dolphins, and seals.[3]

This species is taken in spearfishing[3] and angling.[2]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!