Table of Contents
Overview
Comprehensive Description
Biology
Usually found on or near bottom in kelp beds or rocky areas (Ref. 2850). Viviparous, with planktonic larvae (Ref. 36715).
-
Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
http://www.fishbase.org/references/FBRefSummary.php?id=2850&speccode=2592
© FishBase
Source:
FishBase
Trusted
Distribution
Eastern Pacific: Timber Cove, Sonoma County in central California, USA to central Baja California, Mexico.
-
Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
http://www.fishbase.org/references/FBRefSummary.php?id=2850&speccode=2592
© FishBase
Source:
FishBase
Trusted
Physical Description
Morphology
Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 6 - 7; Vertebrae: 26
-
Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
http://www.fishbase.org/references/FBRefSummary.php?id=36715&speccode=8222
© FishBase
Source:
FishBase
Trusted
Size
Max. size
42.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 20 years (Ref. 39277)
-
Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
http://www.fishbase.org/references/FBRefSummary.php?id=2850&speccode=2592
-
Reilly, P.N., D. Wilson-Vandenberg, R.N. Lea, C. Wilson and M. Sullivan 1994 Recreational angler's guide to the common nearshore fishes of northern and central California. Calif. Dept. Fish. Game, Marine Resources Leaflet. (Ref. 39277)
http://www.fishbase.org/references/FBRefSummary.php?id=39277&speccode=3950
© FishBase
Source:
FishBase
Trusted
Diagnostic Description
Branchiostegal rays: 7 (Ref. 36715).
-
Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
http://www.fishbase.org/references/FBRefSummary.php?id=36715&speccode=8222
© FishBase
Source:
FishBase
Trusted
Type Information
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
Catalog Number: USNM 26903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26870
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
Catalog Number: USNM 26870
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 25054
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island, California, Los Angeles County, California, United States, Pacific
Catalog Number: USNM 25054
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island, California, Los Angeles County, California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island Los Angeles Co., Cal, Los Angeles County, California, United States, Pacific
Catalog Number: USNM 24972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island Los Angeles Co., Cal, Los Angeles County, California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
Catalog Number: USNM 27096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
Catalog Number: USNM 27032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24994
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Wilmington, Los Angeles County, California, United States, Pacific
Catalog Number: USNM 24994
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Wilmington, Los Angeles County, California, United States, Pacific
- Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Ecology
Habitat
Environment
demersal; marine; depth range ? - 46 m (Ref. 2850), usually 9 - 12 m (Ref. 2850)
-
Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
http://www.fishbase.org/references/FBRefSummary.php?id=2850&speccode=2592
© FishBase
Source:
FishBase
Trusted
Depth: 0 - 46m.
Recorded at 46 meters.
Habitat: demersal.
Recorded at 46 meters.
Habitat: demersal.
© FishWise Professional
Source:
FishWise Professional
Trusted
Trophic Strategy
Stomachs were more likely to be empty during the day than at night, suggesting that it is a nocturnal feeder in southern California (Ref. 28090).
-
Hallacher, L.E. and D.A. Roberts 1985 Differential utilization of space and food by the inshore rockfishes (Scorpaenidae: Sabastes) of Carmel Bay, California. Environ. Biol. Fish. 12(2):91-110. (Ref. 28090)
http://www.fishbase.org/references/FBRefSummary.php?id=28090&speccode=3950
© FishBase
Source:
FishBase
Trusted
Life History and Behavior
Life Cycle
Viviparous (Ref. 36715, 34817).
-
Moser, H.G. 1996 Scorpaenidae: scorpionfishes and rockfishes. p. 733-795. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 36715)
http://www.fishbase.org/references/FBRefSummary.php?id=36715&speccode=8222
© FishBase
Source:
FishBase
Trusted
Life Expectancy
Lifespan, longevity, and ageing
Maximum longevity: 20 years (wild)
© Joao Pedro de Magalhaes
Source:
AnAge
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sebastes atrovirens
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 15 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 15 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTACTACTCGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAACATGAAGCCCCCCGCCATCTCTCAGTACCAAACACCCCTATTTGTGTGAGCTGTACTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTACCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGCATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTTACAGTTGGCATGGACGTAGACACACGTGCCTACTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTAGCCAATTCATCTCTAGATATTGTACTCC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Sebastes atrovirens
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
© Ocean Genome Legacy
Source:
Ocean Genome Resource
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
© FishBase
Source:
FishBase
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
