You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

Usually found on or near bottom in kelp beds or rocky areas (Ref. 2850). Viviparous, with planktonic larvae (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Timber Cove, Sonoma County in central California, USA to central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 6 - 7; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 420 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

42.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 20 years (Ref. 39277)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 7 (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 26870
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: California, Santa Barbara., California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 25054
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island, California, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24972
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Catalina Island Los Angeles Co., Cal, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 27032
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Sebastichthys atrovirens Jordan & Gilbert
Catalog Number: USNM 24994
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Wilmington, Los Angeles County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 289.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 46 m (Ref. 2850), usually 9 - 12 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 46m.
Recorded at 46 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Stomachs were more likely to be empty during the day than at night, suggesting that it is a nocturnal feeder in southern California (Ref. 28090).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 20 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes atrovirens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTACTACTCGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAACATGAAGCCCCCCGCCATCTCTCAGTACCAAACACCCCTATTTGTGTGAGCTGTACTAATTACCGCTGTTCTTCTCCTTCTCTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGGTTCTTTGGACACCCGGAAGTATATATTCTCATTTTACCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCCTTTGGCTATATGGGCATAGTATGAGCAATAATGGCTATTGGTCTTCTAGGCTTTATTGTATGAGCTCATCACATATTTACAGTTGGCATGGACGTAGACACACGTGCCTACTTTACATCTGCCACAATAATTATCGCAATTCCCACCGGCGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTAGCCAATTCATCTCTAGATATTGTACTCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes atrovirens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!