Overview

Comprehensive Description

Biology

Usually found offshore (Ref. 27437). Viviparous (Ref. 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Japan to Navarin Canyon in the Bering Sea (but not in the Sea of Okhotsk), throughout the Aleutian Islands, and south to San Diego, California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Japan to Bering Sea and to northern California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 3; Analsoft rays: 6 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 970 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

97.0 cm TL (male/unsexed; (Ref. 9015)); max. published weight: 900 g (Ref. 40637); max. reported age: 140 years (Ref. 72507)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head spines strong - nasal, preocular, supraocular, postocular, tympanic, coronal, parietal and nuchal spines present; 2 to 10 (rarely 0 or 1) spines below the eye on rim of orbit (Ref. 27437). Caudal moderately indented (Ref. 6885). Color variable, reddish background with dusky blotches and speckling (particularly in small specimens); fins may have black edges (Ref. 27437).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Cotype for Sebastodes aleutianus
Catalog Number: USNM 48800
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1897
Locality: Alaska: Kodiak Island, Karluk Head SE. 1/2 E., Alaska, United States, Pacific
Vessel: Albatross
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 25 - 900 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 630 specimens in 1 taxon.
Water temperature and chemistry ranges based on 476 samples.

Environmental ranges
  Depth range (m): 10.5 - 2743
  Temperature range (°C): 1.710 - 8.274
  Nitrate (umol/L): 17.905 - 42.913
  Salinity (PPS): 32.966 - 34.629
  Oxygen (ml/l): 1.106 - 4.614
  Phosphate (umol/l): 1.713 - 3.046
  Silicate (umol/l): 28.547 - 175.223

Graphical representation

Depth range (m): 10.5 - 2743

Temperature range (°C): 1.710 - 8.274

Nitrate (umol/L): 17.905 - 42.913

Salinity (PPS): 32.966 - 34.629

Oxygen (ml/l): 1.106 - 4.614

Phosphate (umol/l): 1.713 - 3.046

Silicate (umol/l): 28.547 - 175.223
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 875m.
From 25 to 875 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 205 years (wild) Observations: These animals feature negligible senescence. It is possible that they live up to 205 years (Cailliet et al. 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes aleutianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCCCCTAATGATTGGGGCCCCAGATATAGCATTTCCTCGTATAAACAACATAAGTTTCTGACTTCTTCCCCCTTCTTTCCTACTACTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACAGTGTACCCGCCCCTGGCTGGTAACTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGTATCTCCTCAATCCTCGGGGCAATCAATTTTATTACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAGTACCAGACACCCCTATTTGTGTGAGCTGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCTCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAACACTTATTCTGGTTTTTTGGGCACCCGGAAGTATATATTCTTATTCTGCCTGGCTTTGGCATGATTTCACACATCGTCGCCTATTATTCTGGTAAGAAAGAACCCTTTGGCTATATAGGCATAGTGTGAGCAATAATGGCTATTGGCCTCCTAGGCTTTATTGTATGAGCTCATCACATATTTACAGTTGGCATGGACGTAGACACGCGTGCTTATTTCACGTCTGCCACAATAATCATCGCAATTCCCACCGGTGTTAAAGTATTTAGCTGACTTGCAACCCTACATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTGTTTACAGTAGGGGGGCTTACAGGCATTGTTCTGGCCAATTCATCTCTAGATATTGTACTCCACGATACCTATTATGTAGTAGCCCACTTCCACTACGTACTATCTATGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes aleutianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rougheye rockfish

The rougheye rockfish (Sebastes aleutianus) is a rockfish of the genus Sebastes. It is also known as the blackthroat rockfish or the blacktip rockfish and grows to a maximum of about 97 cm (38 in) in length,[1] with the IGFA record weight being 14 lb 12 oz (6.7 kg).[3] Similar to many other members of its genus, it is extremely long-lived, and has been known to reach an age of 205 years.[4]

Description[edit]

The rougheye rockfish is so-named because of the ten or so spines found on the lower eyelid. It is pink, tan or brownish with irregular patches of brown of darker color and often a darker patch at the back of the operculum. The posterior part of the lateral line is often pink. An average adult size is about 80 cm (31 in).[5]

Distribution and habitat[edit]

Rougheye rockfish are deepwater fish, and exist between 31° and 66° latitude, in the North Pacific, and specifically along the coast of Japan to the Navarin Canyon in the Bering Sea, to the Aleutian Islands, all the way south to San Diego, California.[1] It is found between 150 and 450 m (492 and 1,476 ft), with larger fish living in deeper water than smaller ones. The temperature at these depths range from 31.4 °F (−0.3 °C) to 41 °F (5.0 °C). These fish live near the seabed over boulders and rocks surrounded by soft substrates and in caves and crevices.[5]

Behaviour[edit]

At some times of year the rougheye rockfish forms schools but during much of the year, larger fish are solitary or roam in small groups. It is among the most long-lived of fish species and individuals are believed to attain an age of over two hundred years.[5] These fish feed on shrimps, crabs, fish, amphipods and mysids. This species is oviparous and spawns between the months of February and June or sometimes between October and January.[5]

References[edit]

  1. ^ a b c Froese, Rainer (15 July 2009). "Sebastes aleutianus, Rougheye rockfish". FishBase. Retrieved 19 December 2009. 
  2. ^ "AnAge entry for Sebastes aleutianus". Retrieved 19 December 2009. 
  3. ^ http://www.iws-scalemaster.com/hall-of-champions/
  4. ^ Cailliet, G.M., Andrews, A.H., Burton, E.J., Watters, D.L., Kline, D.E., Ferry-Graham, L.A. (2001). Age determination and validation studies of marine fishes: do deep-dwellers live longer?. Exp. Gerontol. 36 (4–6): 739–764. doi:10.1016/S0531-5565(00)00239-4. PMID 11295512.
  5. ^ a b c d "Rougheye rockfish". Alaska Fisheries Science Center. Retrieved 2013-12-23. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!