Ecology

Habitat

Depth range based on 42 specimens in 1 taxon.
Water temperature and chemistry ranges based on 20 samples.

Environmental ranges
  Depth range (m): 11 - 1650
  Temperature range (°C): 17.496 - 24.868
  Nitrate (umol/L): 0.260 - 16.890
  Salinity (PPS): 35.682 - 40.755
  Oxygen (ml/l): 0.655 - 4.648
  Phosphate (umol/l): 0.072 - 0.923
  Silicate (umol/l): 1.121 - 16.644

Graphical representation

Depth range (m): 11 - 1650

Temperature range (°C): 17.496 - 24.868

Nitrate (umol/L): 0.260 - 16.890

Salinity (PPS): 35.682 - 40.755

Oxygen (ml/l): 0.655 - 4.648

Phosphate (umol/l): 0.072 - 0.923

Silicate (umol/l): 1.121 - 16.644
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plesionika narval

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATATTTTATATTCGGTGCATGGGCTGGAATGGCGGGGACGTCTTTAAGGCTTCTAATTCGAGCCGAATTAGGACAACCGGGAAGACTCATCGGAAACGATCAAATCTATAACGTAGTAGTCACTGCCCACGCCTTTGTGATAATTTTCTTCATGGTTATACCCATTATAATCGGAGGATTTGGAAATTGACTACTACCCCTCATACTAGGGGCCCCCGATATGGCTTTCCCTCGAATAAACAACATAAGATTCTGATTGCTACCCCCATCCCTAACCCTTCTTCTTTCCAGAGGAATAGTAGAGAGGGGTGTGGGCACCGGGTGGACCGTCTACCCCCCACTCTCCGCTGGGATTGCCCACGCAGGGGCCTCTGTAGACCTGGGAATTTTCTCCCTTCACTTGGCCGGAATCTCCTCTATCCTAGGAGCAGTCAACTTTATAACCACAGTCATTAACATGCGAAGCGGGGGTATAACTCTAGACCGCATGCCTCTATTTGTGTGGGCAGTGTTCCTAACGGCCATTTTATTACTCCTCTCCCTGCCCGTACTTGCCGGCGCCATCACTATGCTTCTCACAGACCGAAATTTAAACACCTCTTTCTTCGACCCAGCGGGAGGGGGTGACCCAATCCTATACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Plesionika narval

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!