Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Baltic isopods live on the bottom of the seabed, between seaweed and eelgrass, and haul oxygen out of the seawater. They eat rotting seaweed. You can also find them on the beach between washed up seaweed. There are various species of isopods that are difficult to tell apart. They are usually best recognized by the shape of the hind shield. Baltic isopods have three thorns on their tail plate.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 A dorso-ventrally flattened crustacean with an elongated oblong, oval body. The body is uniformly green or brown in colour, often with white spots or longitudinal lines. Females are often darker than males. Males range in length from 1-3 cm while females range from 1-1.8 cm. The distinct head bears two dorso-lateral eyes, a pair of short antennules, and a pair of antennae. Most of body is taken up by a thorax composed on seven sections (somites). The body ends in a short abdomen (two somites) and a distinct tail-piece (the pleotelson). The pleotelson in adults is characteristic, with approximately straight sides, a dorsal keel, and a posterior edge bearing three processes, of which the middle one is the longest. The three processes develop with age and are absent in juvenles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Gulf of St. Lawrence to North Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Found at depths of 1-200 m; prefer hard and algae covered substrate.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 147 specimens in 2 taxa.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): -3 - 1439
  Temperature range (°C): 6.832 - 17.140
  Nitrate (umol/L): 0.211 - 5.321
  Salinity (PPS): 6.559 - 38.444
  Oxygen (ml/l): 5.513 - 8.091
  Phosphate (umol/l): 0.095 - 0.547
  Silicate (umol/l): 1.247 - 28.168

Graphical representation

Depth range (m): -3 - 1439

Temperature range (°C): 6.832 - 17.140

Nitrate (umol/L): 0.211 - 5.321

Salinity (PPS): 6.559 - 38.444

Oxygen (ml/l): 5.513 - 8.091

Phosphate (umol/l): 0.095 - 0.547

Silicate (umol/l): 1.247 - 28.168
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 A primarily subtidal species also found in the intertidal feeding on seaweeds but sometimes abundant amongst stranded seaweed on the drift-line.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

20-34
  • Schotte, M., B.F. Kensley, and S. Shilling. (1995 onwards). World list of Marine, Freshwater and Terrestrial Crustacea Isopoda. National Museum of Natural History Smithsonian Institution: Washington D.C., USA.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on decaying vegetation, especially Fucus vesiculosus.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Idotea baltica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 42 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAACGATGATTATATTCAACTAACCATAAGGATATTGGAACATTATATTTTATTTTTGGGGCGTGGGCTGGTGCAGTAGGGACAGCTTTAAGGATGATTATTCGCACGGAGTTAGGACAACCTGGGAGTTTTATTGGAGAT---GATCAGATTTATAATGTAGTTGTTACAGCTCACGCTTTTGTAATAATTTTTTTTATGGTAATACCTGTAATAATTGGTGGGTTTGGTAATTGGTTGGTCCCTTTAATGTTGGGGGCTCCAGAAATAGCTTTTCCGCGGATAAATAGTATAAGCTTTTGGTTACTCCCCCCTTCCCTTATACTGTTGCTCAGGAGGGGGCTAGTAGAGAGGGGTGTTGGAACAGGGTGAACTGTATACCCCCCACTTGCGGCGGGTATTGCGCATAGGGGGGCTTCTGTAGATTTGGGGATTTTCTCTTTACATTTGGCTGGGGCTTCTTCTATTTTAGGGGCTGTCAATTTTATTACAACTGTTATTAATATGCGCCCAGCGGGAATAAGATTTGACCGTATTCCGCTGTTTGTGTGATCTGTTTTTATTACAGCAATTCTTTTACTCTTATCCCTCCCAGTACTGGCCGGAGCTATTACTATACTTTTAACAGACCGTAACCTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGGTACCCTATCTTGTACCAACACCTATTTTTGTTCTTTGGGCACCCTGAGGTTTATATTTTAATTCTTCCCGCCTTTGGAATAATTTCCCACATTATTAGTCAAGAGTCGAGTAAGAAAGAGGCATTCGGAACTTTAGGTATAATCTACGCTATAGTAGCCATTGGAGTTTTAGGGTTTGTAGTTTGAGCCCACCATATTTTTACAGTGGGGATGGATGTAGACACGCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Idotea baltica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 42
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Idotea balthica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGGGCGTGGGCTGGTGCAGTAGGGACAGCTTTAAGGATGATTATTCGCACGGAGTTAGGACAACCTGGGAGTTTTATTGGAGACGATCAGATTTATAATGTAGTAGTTACAGCTCACGCTTTTGTAATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGGTTTGGTAATTGGTTGGTCCCTTTAATGTTGGGGGCTCCAGATATAGCTTTTCCGCGGATAAATAATATAAGCTTTTGGTTACTCCCCCCTTCCCTTATACTGTTGCTCAGGAGGGGGCTAGTAGAGAGGGGTGTTGGAACAGGGTGAACTGTATACCCCCCACTTGCGGCGGGTATTGCGCATAGGGGAGCTTCTGTAGATTTGGGGATTTTCTCTTTACATTTGGCTGGGGCTTCTTCTATTTTAGGGGCTGTCAATTTTATTACAACTGTTATTAATATGCGCCCAGCGGGAATAAGATTTGACCGTATTCCGCTGTTTGTGTGATCTGTTTTTATTACAGCAATTCTTTTACTCTTATCCCTCCCAGTACTGGCCGGAGCTATTACTATACTTTTAACAGACCGTAACCTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGGGACCCTATCTTGTACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Idotea balthica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 39 specimens with morphological vouchers housed at Sea Education Association (SEA) / Ocean Genome Legacy and University of Rhode Island, Kingston
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Idotea balthica

Idotea balthica is a marine isopod which lives on seaweed in the subtidal zone of rocky shores.

Distribution [edit]

Idotea balthica has a broad geographical distribution, having been recorded from the Belgian Exclusive Economic Zone, Great Britain, Cobscook Bay, Dutch Exclusive Economic Zone, European waters, Greek Exclusive Economic Zone, Gulf of Maine, Knokke, North West Atlantic, Red Sea, Voordelta, West Coast of Norway, Wimereux and the Black Sea.[1]

Characteristics [edit]

The male is larger than female, and can reach 4 centimetres (1.6 in) long.[2] The carapace is yellow, brown or green with small white spots; the female is usually darker.[2] The species can be distinguished from other idoteids by the shape of the telson, which is dorsally keeled with straight sides in I. balthica, and has a distinct spine at the end.[2]

References [edit]

  1. ^ Gary Poore & Marilyn Schotte. "Idotea balthica (Pallas, 1772)". In M. Schotte, C. B. Boyko, N. L. Bruce, G. C. B. Poore, S. Taiti & G. D. F. Wilson. World Marine, Freshwater and Terrestrial Isopod Crustaceans database. World Register of Marine Species. Retrieved January 1, 2012. 
  2. ^ a b c Kåre Telsnes. "Baltic Isopod – Idotea balthica". The Marine Flora & Fauna of Norway. Retrieved January 1, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!