Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Pandalus jordani Rathbun, 1902
Catalog Number: USNM 25277
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1889
Locality: Off Santa Cruz Island, California, United States, North Pacific Ocean
Depth (m): 283 to 283
Vessel: Albatross R/V
  • Type: Rathbun, M. J. 1902. Descriptions of new decapod crustaceans from the west coast of North America. Proc. U.S.N.M. 24 (1272): 885?905.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5492 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2878 samples.

Environmental ranges
  Depth range (m): 43.5 - 1276.83
  Temperature range (°C): 4.832 - 8.705
  Nitrate (umol/L): 13.007 - 38.456
  Salinity (PPS): 32.561 - 34.027
  Oxygen (ml/l): 1.332 - 5.506
  Phosphate (umol/l): 1.398 - 2.880
  Silicate (umol/l): 21.984 - 70.929

Graphical representation

Depth range (m): 43.5 - 1276.83

Temperature range (°C): 4.832 - 8.705

Nitrate (umol/L): 13.007 - 38.456

Salinity (PPS): 32.561 - 34.027

Oxygen (ml/l): 1.332 - 5.506

Phosphate (umol/l): 1.398 - 2.880

Silicate (umol/l): 21.984 - 70.929
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus jordani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNTATATTTTATTTTTGGAGCTTGGTCTGGGATAGTGGGAACTTCCTTGANACTTTTAATTCGGGCTGAGTTAGGTCAACCAGGTAGGCTGGTAGGAAACGATCAAATTTATAATGTTGTGGTCACAGCTCACGCTTTTGTAATAATTTTTTTCATAGTAATACCAATTATAATTGGGGGCTTCGGAAACTGACTTGTGCCCTTAATATTAGGTGCCCCAGATATAGCCTTCCCACGAATAAACAACATAAGATTTTGACTTTTACCCCCCTCCCTTACACTCCTTCTCTCTAGTGGAATAGTAGAAAGAGGGGTGGGTACTGGCTGGACAGTGTACCCTCCTTTATCAGCTGGGATTGCACATGCCGGGGCCTCAGTAGACCTTGGGATTTTCTCACTCCACTTAGCAGGAGTGTCTTCTATCTTAGGGGCCGTTAATTTTATAACCACAGTTATTAACATGCGAAGAAGAGGAATATCTATAGACCGGATACCTCTCTTTGTTTGATCTGTTTTTTTAACGGCTCTTTTACTACTTCTATCACTACCGGTTCTTGCCGGAGCAATCACAATACTACTAACAGACCGAAACCTGAATACCTCTTTCTTTGACCCGGCTGGTGGGGGGGACCCTATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus jordani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!