Overview
Distribution
National Distribution
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
Trusted
Physical Description
Type Information
Type for Pandalus jordani Rathbun, 1902
Catalog Number: USNM 25277
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1889
Locality: Off Santa Cruz Island, California, United States, North Pacific Ocean
Depth (m): 283 to 283
Vessel: Albatross R/V
Catalog Number: USNM 25277
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1889
Locality: Off Santa Cruz Island, California, United States, North Pacific Ocean
Depth (m): 283 to 283
Vessel: Albatross R/V
- Type: Rathbun, M. J. 1902. Descriptions of new decapod crustaceans from the west coast of North America. Proc. U.S.N.M. 24 (1272): 885?905.
Trusted
Ecology
Habitat
Depth range based on 5492 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2878 samples.
Environmental ranges
Depth range (m): 43.5 - 1276.83
Temperature range (°C): 4.832 - 8.705
Nitrate (umol/L): 13.007 - 38.456
Salinity (PPS): 32.561 - 34.027
Oxygen (ml/l): 1.332 - 5.506
Phosphate (umol/l): 1.398 - 2.880
Silicate (umol/l): 21.984 - 70.929
Graphical representation
Depth range (m): 43.5 - 1276.83
Temperature range (°C): 4.832 - 8.705
Nitrate (umol/L): 13.007 - 38.456
Salinity (PPS): 32.561 - 34.027
Oxygen (ml/l): 1.332 - 5.506
Phosphate (umol/l): 1.398 - 2.880
Silicate (umol/l): 21.984 - 70.929
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2878 samples.
Environmental ranges
Depth range (m): 43.5 - 1276.83
Temperature range (°C): 4.832 - 8.705
Nitrate (umol/L): 13.007 - 38.456
Salinity (PPS): 32.561 - 34.027
Oxygen (ml/l): 1.332 - 5.506
Phosphate (umol/l): 1.398 - 2.880
Silicate (umol/l): 21.984 - 70.929
Graphical representation
Depth range (m): 43.5 - 1276.83
Temperature range (°C): 4.832 - 8.705
Nitrate (umol/L): 13.007 - 38.456
Salinity (PPS): 32.561 - 34.027
Oxygen (ml/l): 1.332 - 5.506
Phosphate (umol/l): 1.398 - 2.880
Silicate (umol/l): 21.984 - 70.929
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pandalus jordani
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNNNNNNTATATTTTATTTTTGGAGCTTGGTCTGGGATAGTGGGAACTTCCTTGANACTTTTAATTCGGGCTGAGTTAGGTCAACCAGGTAGGCTGGTAGGAAACGATCAAATTTATAATGTTGTGGTCACAGCTCACGCTTTTGTAATAATTTTTTTCATAGTAATACCAATTATAATTGGGGGCTTCGGAAACTGACTTGTGCCCTTAATATTAGGTGCCCCAGATATAGCCTTCCCACGAATAAACAACATAAGATTTTGACTTTTACCCCCCTCCCTTACACTCCTTCTCTCTAGTGGAATAGTAGAAAGAGGGGTGGGTACTGGCTGGACAGTGTACCCTCCTTTATCAGCTGGGATTGCACATGCCGGGGCCTCAGTAGACCTTGGGATTTTCTCACTCCACTTAGCAGGAGTGTCTTCTATCTTAGGGGCCGTTAATTTTATAACCACAGTTATTAACATGCGAAGAAGAGGAATATCTATAGACCGGATACCTCTCTTTGTTTGATCTGTTTTTTTAACGGCTCTTTTACTACTTCTATCACTACCGGTTCTTGCCGGAGCAATCACAATACTACTAACAGACCGAAACCTGAATACCTCTTTCTTTGACCCGGCTGGTGGGGGGGACCCTATCTTATACCAACATTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pandalus jordani
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Trusted
Conservation
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

