Overview

Brief Summary

Bathynomus giganteus is a species of giant isopod thought to be abundant in cold, deep waters of the Atlantic. It is related to the terrestrial woodlouse and pill bug. Giant isopods are prime examples of deep-sea gigantism. This species is known to be scavengers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 84 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 29 - 2138
  Temperature range (°C): 4.063 - 24.824
  Nitrate (umol/L): 0.871 - 34.243
  Salinity (PPS): 34.582 - 36.495
  Oxygen (ml/l): 2.683 - 4.970
  Phosphate (umol/l): 0.107 - 2.248
  Silicate (umol/l): 1.413 - 28.581

Graphical representation

Depth range (m): 29 - 2138

Temperature range (°C): 4.063 - 24.824

Nitrate (umol/L): 0.871 - 34.243

Salinity (PPS): 34.582 - 36.495

Oxygen (ml/l): 2.683 - 4.970

Phosphate (umol/l): 0.107 - 2.248

Silicate (umol/l): 1.413 - 28.581
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

310-2140
  • Schotte, M., B.F. Kensley, and S. Shilling. (1995 onwards). World list of Marine, Freshwater and Terrestrial Crustacea Isopoda. National Museum of Natural History Smithsonian Institution: Washington D.C., USA.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathynomus giganteus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGGGTACAGCTTTCAGTATGCTAATCCGCCTTGAATTATCTGCCCCAGGTACTATGTTAGGGGAC---GATCAACTTTATAATGTTTTAGTAACAGCTCATGCTTTTGTTATGATTTTCTTCCTTGTTATGCCAGTTATGATTGGTGGGTTTGGGAATTGACTAGTTCCCCTTTACATTGGGGCCCCCGACATGGCTTTTCCCCGTTTAAACAATATTAGCTTTTGACTTTTACCCCCAGCTTTAATTCTTTTACTAGGGTCCTCTTTAATTGAACAAGGTGTGGGTACTGGTTGAACAGTTTACCCTCCCCTTTCAGGTATCCAAGCTCATTCCGGTGGTGCTGTTGACATGGGAATTTTTAGTCTTCACTTAGCTGGTGCTTCATCTATATTAGGAGCTATGAACTTTATCACCACTATTTTTAATATGCGTGCCCCAGGAGTAACTTGGGATAAGCTTCCCTTATTTGTTTGATCAGTTCTAATCACAGCCTTTTTACTACTCCTATCTTTGCCTGTACTAGCAGGAGCAATTACTATGCTTTTAACTGATAGGAATTTTAACACATCATTCTTTGATCCTGCTGGAGGTGGTGATCCAATTTTATTTCAACAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathynomus giganteus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!