Overview

Distribution

Range Description

This species is known from New Caledonia and French Polynesia (Holthuis 1980). There are also records from Kerala and Tamil Nadu in India (Jayachandran 2001), but these are considered doubtful.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species lives in rivers and streams.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrobrachium aemulum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAGGAGCCCCAGACATGGCCTTCCCACGAATAAATAACATAAGATTTTGACTATTACCCCCCTCACTAACACTACTACTATCCAGAGGAATGGTAGAAAGAGGGGTTGGCACAGGATGAACTGTATACCCCCCTCTAGCAGCTGGCACTGCCCATGCTGGAGCTTCAGTTGACTTGGGA---ATCTTTTCCCTCCACTTAGCCGGTGTTTCATCAATCCTGGGAGCCGTAAATTTTATTACCACAGTAATTAACATACGGGCCTCAGGAATGACGATAGACCGACTTCCCCTATTCGTATGGGCCGTGTTCTTAACGGCAATTCTCCTTCTACTATCACTCCCAGTTCTCGCCGGG---GCCATCACAATGTTACTAACTGATCGAAACTTAAACACATCCTTCTTTGACCCTGCCGGAGGGGGTGACCCAATTCTCTACCAACACCTATTCTGATTTTTCGGGCACCCTGAAGTATACATTCTAATTCTTCCAGCCTTCGGTATAATTTCGCACATTGTAAGGCAGGAATCAGGTAAAAAA---GAATCATTCGGCACACTAGGAATAGTTTATGCTATAATGGCCATTGGAGTTCTCGGGTTCGTTGTATGAGCACACCATATATTCACCGTAGGAATGGACGTAGACACACGAGCCTACTTCACATCTGCCACAATGATTATTGCCGTCCCAACAGGGATTAAAATCTTCAGGTGACTA---GCTACTTTACATGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macrobrachium aemulum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
De Grave, S., Klotz, W. & Wowor, D.

Reviewer/s
Cumberlidge, N. & Smith, K.

Contributor/s

Justification
This species is known from New Caledonia and French Polynesia. There are also records from Kerala and Tamil Nadu in India (Jayachandran 2001), but these are considered doubtful. The species occurs in freshwater streams and rivers. In view of this wide distribution and the absence of any known, major threats, the species is considered as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No information is available on population trends.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

No specific threats to this species have been identified.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

No specific conservation actions are in place.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!