Overview

Distribution

North and Central America and Caribbean Islands
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Syntype for Hyalella ornata Pearse
Catalog Number: USNM 64338
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1910
Locality: Lake Catamaco, Veracruz, Mexico
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Hyalella ornata Pearse
Catalog Number: USNM 98403
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Ruthven
Year Collected: 1910
Locality: Lake Catemaco, Veracruz, Mexico
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found from shallow waters to 30 feet depth in sand and under stones.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 9

Graphical representation

Depth range (m): 0.5 - 9
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Hyalella azteca (Hyallella azteca) preys on:
Cladophora glomerata
detritus
Achnanthes
Caloneis
Cocconeis
Diatoma
Epithemia
Gomphonema
Gyrosigma
Meridion
Navicula
Nitzschia
Rhoicoenia
Surirella
Synedra

Based on studies in:
USA: Idaho-Utah, Deep Creek (River)

This list may not be complete but is based on published studies.
  • D. G. Koslucher and G. W. Minshall, 1973. Food habits of some benthic invertebrates in a northern cool-desert stream (Deep Creek, Curlew Valley, Idaho-Utah). Trans. Amer. Micros. Soc. 92:441-452, from pp. 446-50.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Hyalella azteca (Hyallella azteca) is prey of:
Argia vivida
Enallagma anna
Ophiogomphus severus

Based on studies in:
USA: Idaho-Utah, Deep Creek (River)

This list may not be complete but is based on published studies.
  • D. G. Koslucher and G. W. Minshall, 1973. Food habits of some benthic invertebrates in a northern cool-desert stream (Deep Creek, Curlew Valley, Idaho-Utah). Trans. Amer. Micros. Soc. 92:441-452, from pp. 446-50.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hyalella azteca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 203 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACCCTGTACTTTGTATTGGGGGCCTGGGCGAGCGCGGTTGGGACTTCTCTTAGAGTGATCATTCGGTCAGAGCTCAGTAGGCCCGGTAATTTAATCGGAGACGATCAAATTTATAATGTGGTCGTAACTGCACATGCTTTTGTTATAATCTTTTTTATGGTCATGCCTATCATGATCGGGGGGTTCGGCAATTGGCTAGTGCCCGTTATGCTAGGAAGCCCGGACATGGCTTTTCCTCGAATAAACAACATAAGGTTCTGACTTTTGCCCCCTTCTTTAGTACTTCTTTTGATGAGAGGCATAGTAGAGAGTGGAGTAGGGACAGGCTGGACTGTGTATCCTCCGCTATCAGGCAATGTCGCTCACAGGGGGAGGTCAGTAGATATGGCTATTTTTTCATTACATCTGGCAGGTGCGTCTTCAATCTTGGGGGCTATTAATTTTATTTCGACGGTTTTAAACATGCGAACCTCGGGGATAAGAATAGACCGAGTGCCCTTATTTGTTTGGTCCGTGTTTATTACGGCCATTCTTTTGTTATTGTCTTTGCCTGTTCTAGCCGGGGCAATCACTATGTTGCTTACTGACCGAAACCTTAATACCTCTTTTTTTGATCCAAGCGGCGGTGGCGATCCTATTTTATACCAGCATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hyalella azteca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 168
Specimens with Barcodes: 361
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hyalella azteca

Hyalella azteca is a widespread and abundant species of amphipod crustacean in North America. It reaches 3–8 mm (0.12–0.31 in) long, and is found in a range of fresh and brackish waters. It feeds on algae and diatoms and is a major food of waterfowl.

Contents

Description

Hyalella azteca grows to a length of 3–8 millimetres (0.12–0.31 in), with males being larger than females.[1] Their colour is variable, but the most frequent hues are white, green and brown.[1]

Distribution

Hyalella azteca is found across Central America, the Caribbean and North America,[2] as far north as the Arctic tree line.[1] It lives among vegetation in permanent bodies of freshwater, including lakes and rivers,[1] extending into tidal fresh water, and freshwater barrier lagoons.[2] It is "the most abundant amphipod of lakes [in North America]".[3]

Ecology

In contrast to other species of Hyalella, H. azteca is extremely common and has wide ecological tolerances.[4] It can tolerate alkaline waters and brackish waters, but cannot tolerate a pH lower (more acidic) than 6.0.[4]

The main foodstuffs of H. azteca are filamentous algae and diatoms, although they may also consume organic detritus.[1] It cannot assimilate either cellulose or lignin, even though these biomolecules are a major component of the leaf litter.[5] It can, however, assimilate 60%–90% of the bacterial biomass that it ingests.[5]

Hyalella azteca is an important food for many waterfowl. In Saskatchewan, 97% of the diet of female White-winged Scoters was observed to be H. azteca, and it also makes up a significant part of the diet of Lesser Scaup.[6]

Life cycle

Hyalella azteca passes through a minimum of nine instars during its development.[4] Sexes can first be distinguished at the 6th instar, with the first mating occurring in the 8th instar. Subsequent instars, of which there may be 15–20, are considered adulthood.[4]

Uses

Hyalella azteca is used in various aquatic bioassays.[7]

Taxonomic history

Hyalella azteca was first described by Henri Louis Frédéric de Saussure in 1858, under the name Amphitoe aztecus, based on material collected by Aztecs[8] from a "cistern" near Veracruz, Mexico.[9] It has also been described under several junior synonyms, including:[10]

When Sidney Irving Smith erected the genus Hyalella in 1874, H. azteca was the only included species, and therefore the type species.[11] The genus now includes dozens of species, mostly in South America.[11]

H. azteca is now thought to represent a species complex, since there is little gene flow between populations, and different morphotypes are known to coexist in some areas.[8] Two local populations have been described as separate species – Hyalella texana from the Edwards Plateau of Texas, and Hyalella montezuma from Montezuma Well, Arizona.[8]

References

  1. ^ a b c d e "Aquatic Invertebrates: Amphipods". The Nature of the Rideau River. Canadian Museum of Nature. May 18, 2007. Retrieved October 5, 2010. 
  2. ^ a b Mark D. Sytsma, Jeffery R. Cordell, John W. Chapman & Robyn C. Draheim (October 2004). "Final Technical Report: Appendices" (PDF). Lower Columbia River Aquatic Nonindigenous Species Survey 2001–2004. United States Fish and Wildlife Service. Retrieved October 6, 2010. 
  3. ^ C. F. Mason (2002). "Acidification". Biology of Freshwater Pollution (4th ed.). Pearson Education. pp. 175–204. ISBN 978-0-13-090639-7. 
  4. ^ a b c d Douglas Grant Smith (2001). "Amphipoda". Pennak's freshwater invertebrates of the United States: Porifera to Crustacea (4th ed.). John Wiley and Sons. pp. 569–584. ISBN 978-0-471-35837-4. 
  5. ^ a b N. Kaushik (1975). "Decomposition of allochthonous organic matter and secondary production in stream ecosystems". Productivity of World Ecosystems: Proceedings of a Symposium Presented August 31–September 1, 1972, at the V General Assembly of the Special Committee for the International Biological Program, Seattle, Washington. United States National Academy of Sciences. pp. 90–95. ISBN 0-309-02317-3. 
  6. ^ Gary L. Krapu & Kenneth J. Reinecke (1992). "Foraging ecology and nutrition". Ecology and Management of Breeding Waterfowl. University of Minnesota Press. pp. 1–29. ISBN 978-0-8166-2001-2. 
  7. ^ Robert Jay Goldstein, Rodney W. Harper & Richard Edwards (2000). "Foods and feeding". American Aquarium Fishes. Volume 28 of W. L. Moody, Jr., natural history series. Texas A&M University Press. pp. 43–51. ISBN 978-0-89096-880-2. 
  8. ^ a b c Yihao Duan, Sheldon I. Guttman, James T. Oris & A. John Bailer (2000). "Genetic structure and relationships among populations of Hyalella azteca and H. montezuma (Crustacea:Amphipoda)". Journal of the North American Benthological Society 19 (2): 308–320. JSTOR 1468073. 
  9. ^ Exequiel R. Gonzalez & Les Watling (2002). "Redescription of Hyalella azteca from its type locality, Vera Cruz, Mexico (Amphipoda: Hyalellidae)". Journal of Crustacean Biology 22 (1): 173–183. doi:10.1651/0278-0372(2002)022[0173:ROHAFI]2.0.CO;2. JSTOR 1549618. 
  10. ^ J. Lowry (2010). "Hyalella azteca (Saussure, 1858)". In J. Lowry. World Amphipoda database. World Register of Marine Species. Retrieved October 5, 2010. 
  11. ^ a b J. Laurens Barnard (1969). "The Families and Genera of Marine Gammaridean Amphipoda". United States National Museum Bulletin 271: 1–535. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!