Overview
Distribution
Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
-
Shih, C.T., A.J.G. Figueira & E.H. Grainger, 1971. A synopsis of Canadian marine zooplankton. Bull. Fish. Res. Bd Can. 176 : 1-264.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=31636
Trusted
National Distribution
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
Trusted
Ecology
Habitat
Depth range based on 811 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.1 - 193.5
Temperature range (°C): 6.972 - 10.120
Nitrate (umol/L): 6.582 - 27.466
Salinity (PPS): 32.059 - 33.609
Oxygen (ml/l): 3.282 - 6.545
Phosphate (umol/l): 0.929 - 2.261
Silicate (umol/l): 14.586 - 43.852
Graphical representation
Depth range (m): 0.1 - 193.5
Temperature range (°C): 6.972 - 10.120
Nitrate (umol/L): 6.582 - 27.466
Salinity (PPS): 32.059 - 33.609
Oxygen (ml/l): 3.282 - 6.545
Phosphate (umol/l): 0.929 - 2.261
Silicate (umol/l): 14.586 - 43.852
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.1 - 193.5
Temperature range (°C): 6.972 - 10.120
Nitrate (umol/L): 6.582 - 27.466
Salinity (PPS): 32.059 - 33.609
Oxygen (ml/l): 3.282 - 6.545
Phosphate (umol/l): 0.929 - 2.261
Silicate (umol/l): 14.586 - 43.852
Graphical representation
Depth range (m): 0.1 - 193.5
Temperature range (°C): 6.972 - 10.120
Nitrate (umol/L): 6.582 - 27.466
Salinity (PPS): 32.059 - 33.609
Oxygen (ml/l): 3.282 - 6.545
Phosphate (umol/l): 0.929 - 2.261
Silicate (umol/l): 14.586 - 43.852
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pandalus hypsinotus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNNNCATTATATTTCATCTTTGGAGCCTGATCTGGGATAGTAGGAACTTCCCTAAGACTTTTAATTCGGGCTGAACTTGGTCAACCCGGGAGATTAGTTGGGAACGACCAAATCTACAACGTTGTAGTTACAGCCCACGCTTTTGTAATAATTTTTTTCATAGTAATGCCAATTATAATTGGAGGCTTCGGAAATTGATTAGTGCCGCTAATACTAGGTGCCCCAGATATGGCTTTTCCACGAATAAACAATATAAGATTTTGACTTTTACCCCCATCTCTAACACTCCTCCTATCTAGCGGGATAGTAGAAAGTGGGGTTGGCACTGGATGAACAGTGTACCCCCCTTTATCAGCAGGGATCGCTCATGCCGGGGCTTCAGTCGACCTTGGAATCTTTTCACTTCACCTAGCAGGAGTTTCTTCTATTTTAGGTGCTGTTAATTTCATAACCACTGTAATTAATATACGAAGAAGAGGAATATCTATAGATCGAATACCTTTATTTGTTTGATCTGTTTTTTTAACTGCTCTTTTATTACTTCTTTCTTTACCAGTTCTTGCCGGGGCAATCACGATATTATTAACAGACCGGAACTTAAATACCTCTTTCTTTGACCCCGCCGGAGGAGGAGACCCTATTTTATATCAACACTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Pandalus hypsinotus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Conservation
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

