Overview

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 811 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.1 - 193.5
  Temperature range (°C): 6.972 - 10.120
  Nitrate (umol/L): 6.582 - 27.466
  Salinity (PPS): 32.059 - 33.609
  Oxygen (ml/l): 3.282 - 6.545
  Phosphate (umol/l): 0.929 - 2.261
  Silicate (umol/l): 14.586 - 43.852

Graphical representation

Depth range (m): 0.1 - 193.5

Temperature range (°C): 6.972 - 10.120

Nitrate (umol/L): 6.582 - 27.466

Salinity (PPS): 32.059 - 33.609

Oxygen (ml/l): 3.282 - 6.545

Phosphate (umol/l): 0.929 - 2.261

Silicate (umol/l): 14.586 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus hypsinotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCATTATATTTCATCTTTGGAGCCTGATCTGGGATAGTAGGAACTTCCCTAAGACTTTTAATTCGGGCTGAACTTGGTCAACCCGGGAGATTAGTTGGGAACGACCAAATCTACAACGTTGTAGTTACAGCCCACGCTTTTGTAATAATTTTTTTCATAGTAATGCCAATTATAATTGGAGGCTTCGGAAATTGATTAGTGCCGCTAATACTAGGTGCCCCAGATATGGCTTTTCCACGAATAAACAATATAAGATTTTGACTTTTACCCCCATCTCTAACACTCCTCCTATCTAGCGGGATAGTAGAAAGTGGGGTTGGCACTGGATGAACAGTGTACCCCCCTTTATCAGCAGGGATCGCTCATGCCGGGGCTTCAGTCGACCTTGGAATCTTTTCACTTCACCTAGCAGGAGTTTCTTCTATTTTAGGTGCTGTTAATTTCATAACCACTGTAATTAATATACGAAGAAGAGGAATATCTATAGATCGAATACCTTTATTTGTTTGATCTGTTTTTTTAACTGCTCTTTTATTACTTCTTTCTTTACCAGTTCTTGCCGGGGCAATCACGATATTATTAACAGACCGGAACTTAAATACCTCTTTCTTTGACCCCGCCGGAGGAGGAGACCCTATTTTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus hypsinotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!