Overview

Comprehensive Description

Biology/Natural History: A common inhabitant of deep sandy bottoms in the Rosario area. Feed on crustaceans, polychaetes, limpets, and carcasses. One important predator is the giant octopus Octopus dofleini and the yelloweye rockfish Sebastes ruberrimus. One interesting feature about this species is that it has a different number of multiarticulations on the carpus of its two second pereopods: The left pereopod has 27-31 articles and is longer, while the shorter right second pereopod has only 8 or 9 articles on the carpus. Breeding ends in late October. Females carry their eggs on the abdomen for 4-5 months, remain in deep water. Eggs hatch in March or April. Larvae settle from the plankton in May and June. Juveniles feed in shallow water during summer, especially among Agarum fimbriatum and A. clathratum kelp. They seem to avoid Laminaria saccharina. During their second fall (carapace length 2.8 cm) they become males, which they remain until they grow to 3.3 cm carapace length, at which time they become females. Females may mate only once. May not live longer than 4 years.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

This large benthic shrimp (up to 25 cm long) has the typical multiarticulated second pereopod (photo) and long rostrum (1.2 to 2x the carapace length for this species) characteristic of family Pandalidae (photo). Antenna 1 is only about as long as the carapace. Abdominal segment 3 does not have a median dorsal ridge and spine (photo). Only the anterior half of the carapace has median dorsal spines (photo). Abdominal segment 6 is less than twice as long as wide (photo). This species is reddish with longitudinal white stripes on the carapace (photo) and a distinctive white spot on the sides of the first and fifth abdominal segments (photo). Their pereopods and antennae are banded dark red and lighter red or white. Juveniles may be red, or may be brown or green. The abdomen is smooth and shiny but the carapace is covered with a fuzzy layer of short, fine setae.
  • Wicksten,Mary K., 2009. ; Decapod Crustacea of the Californian and OregonianZoogeographic Provinces. ; UC San Diego Scripps Institution of OceanographyLibrary, Scripps Institution of Oceanography. ; http://escholarship.org/uc/item/7sk92dz ;418 pages. ; Published online only. ; This excellent key coversdecapods (crustaceans such as crabs, shrimp, spiny lobsters, hermit crabs,and crayfish) from shallow and deep water from Puget Sound south to thePacific coast of Baja California. ; Includes many subkeys, drawings,and photos. ; No glossary, table of contents, or index. ; Thisis the place to go for the most up-to-date key for decapods. ; MaryWicksten plans to publish an updated version of this key soon.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Wicksten+2009 External link.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Unalaska, Alaska to San Diego, CA; Sea of Japan and Korea Strait

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This is the largest shrimp on the west coast of North America. The large size and white spot on the abdomen are distinctive. Pandalus tridens has a 6th abdominal segment 3 times as long as wide.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3241 specimens in 1 taxon.
Water temperature and chemistry ranges based on 907 samples.

Environmental ranges
  Depth range (m): 8 - 2648.38
  Temperature range (°C): 1.763 - 8.705
  Nitrate (umol/L): 8.176 - 44.096
  Salinity (PPS): 32.040 - 34.637
  Oxygen (ml/l): 0.895 - 6.859
  Phosphate (umol/l): 1.214 - 3.186
  Silicate (umol/l): 15.307 - 176.841

Graphical representation

Depth range (m): 8 - 2648.38

Temperature range (°C): 1.763 - 8.705

Nitrate (umol/L): 8.176 - 44.096

Salinity (PPS): 32.040 - 34.637

Oxygen (ml/l): 0.895 - 6.859

Phosphate (umol/l): 1.214 - 3.186

Silicate (umol/l): 15.307 - 176.841
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Low intertidal to 487 meters. Mostly well below the intertidal zone.

Habitat: Subtidal rocky and sandy habitats. We frequently catch them on by otter trawl in the San Juan Channel on bottoms of shelly hash. Juveniles come shallower, even into the lower intertidal zone where they hide in crevices and under boulders during the day.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus platyceros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACATTATATTTTATCTTTGGAGCCTGATCTGGCATAGTAGGAACTTCTCTAAGACTTTTAATTCGAGCAGAACTTGGTCAACCCGGCAGATTAGTTGGAAACGACCAAATCTACAATGTTGTAGTCACAGCTCACGCTTTCGTTATAATTTTTTTTATGGTAATACCAATCATAATTGGAGGCTTCGGAAATTGACTAGTACCCCTAATATTAGGAGCCCCAGATATGGCCTTTCCACGAATAAATAACATAAGATTTTGGCTCCTTCCCCCATCCCTTACTCTCCTACTCTCCAGTGGAATGGTAGAAAGCGGTGTTGGTACCGGATGAACAGTATACCCCCCTCTATCAGCAGGAATTGCTCATGCCGGAGCTTCAGTTGACCTTGGTATTTTTTCTCTTCACCTAGCAGGAGTCTCTTCTATTTTAGGGGCTGTTAATTTCATAACCACAGTAATCAACATGCGAAGAAGAGGAATATCTATAGACCGAATACCCTTATTTGTTTGATCTGTCTTCTTAACTGCCCTATTATTACTCCTCTCGCTCCCAGTTCTTGCCGGCGCAATCACAATATTACTAACAGATCGAAACTTAAATACTTCTTTCTTTGACCCCGCCGGAGGAGGGGACCCTATCCTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus platyceros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pandalus platyceros

Pandalus platyceros, also called California spot prawn or Alaskan prawn, is a shrimp of the genus Pandalus.[1]

Spot shrimp are a large shrimp found in the North Pacific. They range from the waters off Unalaska Island, Alaska, to San Diego. The commercial spot prawn fishery along the British Columbia coast is considered sustainable and provides the largest landed value to the BC shrimp fishery. [2]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!