Overview

Distribution

Geographic Range

Cancer antennarius is found in intertidal waters off of the Pacific coast of North America. Areas between San Francisco, California and Baja California, Mexico are where the crab is most abundant, though Sequim, Washington marks the northern range limit (Carroll, 1989).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults can have a carapace width of up to 155 mm, though females never exceed a width of 145 mm. The carapace is widest at the eighth, of nine, anterolateral teeth. The dorsal coloration is usually a deep red or brown, although this can vary to shades of orange or gray. The ventral side is white, with characteristic red spotting. The powerful claws are black-tipped, and the walking legs are almost always hairy. The latter trait is more common in females. The first antennae of C. antennarius are located between the eye stalks, and are distinctively long compared to others in this genus. As with all members of the Cancer genus, males have a more slender, pointed abdomen than do the females (Carroll, 1989; Mohler et al., 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Cancer antennarius Stimpson, 1856
Catalog Number: USNM 2033
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male; female;
Preparation: Alcohol (Ethanol)
Collector(s): W. Stimpson
Locality: San Francisco, California, United States, North Pacific Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The habitat of C. antennarius ranges from the low intertidal zone to depths in excess of 100 meters. The animal is found on both sandy and rocky substrates, though the rocky environment seems to be preferred. During low tide, C. antennarius is often seen under rocky overhangs and deep within crevices (Carroll, 1989).

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Cancer antennarius feeds by means of scavenging and predation. The animal's diet consists of a variety of bivalves, snails and echinoderms, as well as other crustaceans such as hermit crabs. I have personally kept a number of these animals, and have fed them a diet of shrimp and squid. This mixture seems to be quite suitable for the animal in an aquarium setting. C. antennarius is quite sensitive to the odor of food in the water, and this ability serves as a major means of locating food.

Animals that prey upon adult C. antennarius include sea otters, sharks, octopuses, and large sea bass. The animal is most vulnerable to attack after it has molted. At this time, the shell is soft, and the animal has little protection against predators. Juvenile members of this species are preyed upon by a variety of benthic fishes, including, but not limited to, scorpionfish, cabezon, sand bass, and rockfishes. The polychaete worm Iphitime holobranchiata is known to infest the gills of this particular rock crab, and the infestation is sometimes lethal (Carroll, 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Mating most commonly occurs in the spring and fall. The process is carried out after the female molts, and while her shell is in a soft condition. Mating is stimulated by the release of a female pheromone. The males latch onto the females, and stay in that position until the shell of the female has hardened. During the courtship, a spermatophore is placed within the female. The sperm within this packet can be utilized for multiple spawnings. The spermatophore hardens within the female's reproductive tract, thus preventing other males from fertilizing her eggs. The eggs are extruded eleven weeks after the mating, and are fertilized internally as the female releases them. After a period of 7-8 weeks, the larvae hatch from the orange-colored mass of eggs. The larvae progress through six stages of growth, and are planktonic while doing so. Ocean currents cause the larvae to become widely distributed over the continental shelf. It is not until the last stage of larval growth that the animal moves inshore (Carroll, 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cancer antennarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAACAATATGAGTTTTTGACTCTTACCTCCTTCTCTAACATTACTCCTTATAAGAGGTATAGTAGAAAGAGGAGTTGGAACAGGCTGAACTGTTTACCCTCCTTTAGCAGGAGCTATTGCTCATCGTGGCGCCTCAGTTGATATAGGAATTTTCTCCTTACACTTAGCAGGAGTTTCTTCTATCTTAGGAGCTGTAAACTTTATAACAACCGTAATTAATATACGATCTTTTGGAATAACCTTAGATCAAATACCTCTCTTTGTTTGAGCTGTATTTATTACTGCCATCCTATTACTTTTATCTCTCCCTGTCTTAGCAGGTGCAATTACTATATTATTGACTGACCGAAATCTTAATACCTCATTCTTTGACCCCGCAGAGGNAGGAGACCCTGTTCTTTACCAACACCTTTTCTGATTTTTTGGNCACCCAGAGGTTATATATCTTATTTTACCTGCTTTTGGAATAATTTCTCATATTGTGAGACAAGAATCTGGTAAAAAAGAGTCCTTTGGGACCCTAGGAATAATTTACGCCATATTAGCTATTGGAATCCTAGGGTTTGTTGTTTGAGCACACCATATATTTACAGTGGGTATAGACGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cancer antennarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The only known conservation efforts surrounding Cancer antennarius are centered in the fishing industry. State agencies impose catch limits on the crab, both for quantity and size (Carroll, 1989).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no known negative impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

With a taste that is reportedly similar to that of the Dungeness crab, Cancer antennarius is fished both commercially and recreationally. The industry is minor, however, when compared to the fishery of Cancer magister, the Dungeness crab. Most fishing of C. antennarius is centered in California, and localized overfishing does occur (Carroll, 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!