Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

White-beaked dolphins are boisterous swimmers and like to surf in the waves of ship bows. They live in groups of six to twenty animals. Since around 1955, the white-beaked dolphin is seen regularly in the North Sea. They are presently the most common dolphin species in the North Sea. There are probably between 7000 and 8000 white-beaked dolphins living in the North Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

White-beaked dolphins feed on living, benthic, shallow water fish. Their food varies according to the region and probably depends on the local availability. The stomach content of those washed ashore at the Belgian coast consisted amongst others of whiting, cod, haddock, hake, herring, plaice, mackerel and cephalopods and some benthic crustaceans. 

 These dolphins are mostly found living far offshore, normally in shoals of 6 to 20, although in one exceptional case of more than 1500. They are often observed together with the Atlantic white-sided dolphin. They are powerful swimmers who love to surf on bow waves of ships.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

White-beaked dolphins have similar habits to Atlantic white-sided dolphins, and live in similar cold-water regions of the North Atlantic. They eat fish, squid, octopus, and crustaceans. They are seen in small groups, but also in schools of 500. They often follow ships or ride their bow waves, and can be very acrobatic. They sometimes strand, but not in large groups. They can also get trapped in pack ice or caught in fish nets. Studying trapped or stranded individuals has produced some information. The mean length of mature females is thought to be about 2.3-2.4 m, and newborns are probably 1.1-1.2 m long. Males are slightly larger: the smallest mature male measured 2.51 m. Sexual maturity of males is determined by dissecting them. The testes of cetaceans are internal, are small in juveniles, and become much larger at maturity.

Links:
Mammal Species of the World
  • Original description: Gray, 1846.  Annals and Magazine of Natural History. [ser. 1] 17:84.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The white-beaked dolphin is an extremely active, fast-swimming species. They often ride the bow of boats and may be seen breaching (leaping out of the water and landing back in the water with a splash) or clearing the water when swimming fast (5). It is a social species that forms groups of between 1 to 35 individuals, but occasionally groups of up to 1,500 have been observed (6). It feeds on schooling fish, crustaceans and cephalopods (2). A single calf is born in summer (7), measuring 1.2 metres in length at birth (2). A range of vocalisations including bursts of clicks and squeals are used to communicate, and may also be important in detecting prey and navigation (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Despite the common and Latin names (albirostris means 'white beak' (2)), the short, stocky beak of the white-beaked dolphin is not always white. It may be black and white, grey and white, completely white or even black in colour in certain parts of the range (5). This large dolphin has a rotund body, with a high dorsal fin placed in the centre of the back, behind which there is a characteristic greyish white patch that allows this species to be easily identified (5). The back, tail and flippers are black or grey in colour, and the belly is white or pale grey (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The white-beaked dolphin Lagenorhynchus albirostris reaches 2.4 - 3.2 m in length, with males growing slightly larger than females. It has moderately long and slender flippers and small tail flukes. The dorsal fin is tall, large, falcate, black in colour and located on the middle of the back. The head is smoothly sloping with a distinct but small snout. It has a complex, gradually changing colour pattern. The dorsal and lateral colouration is dark grey and the belly and beak are white. Wisp-like light grey colouration on the flanks, visible from the surface in-front of the dorsal fin and a light grey saddle behind the dorsal fin. The distinctive white beak can sometimes be smokey or even dark grey in the western Atlantic individuals, but is usually white in European specimens.White-beaked dolphins are usually found in pods of up to 30 animals, but several thousand individuals are sometimes seen together. Mixed schools with other species including Atlantic white-sided dolphins, Lagenorhynchus acutus, have been recorded. Their surface behaviour is typical of dolphins with frequent acrobatic leaps and although uncommon, bow-riding behaviour is occasionally seen. Dive duration is unknown (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Belgian Exclusive Economic Zone, British Isles, Dutch Exclusive Economic Zone, European waters (ERMS scope), Faeroes, French Exclusive Economic Zone [Atlantic part], Greenlandic Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Hebrides, Icelandic Exclusive Economic Zone, Kattegat, Mediterranean Sea, North Sea, North West Atlantic, Northern North Atlantic, Norwegian Exclusive Economic Zone, Oostende, Orkney, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Scotland, Shetlands, Skagerrak, Southern Bight, Spanish Exclusive Economic Zone, Spanish Exclusive Economic Zone [Atlantic part], St. Lawrence Estuary, United Kingdom Exclusive Economic Zone, West Mediterranean, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is the most northerly member of the genus Lagenorhynchus, and it has a wide distribution (Kinze 2002). White-beaked dolphins inhabit cold temperate to subpolar waters of the North Atlantic, from Cape Cod and France, north to central Davis Strait, southern Greenland, Svalbard, and east to Novaya Zemlya. The range includes Iceland, Faroe Islands, the U.K., and most Scandinavian waters. There are a few extralimital records in the Baltica Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North Atlantic and adjacent waters from Davis Strait and Cape Cod to Barents Sea, the Baltic Sea, Portugal and possibly Turkey (Nowak 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern East and West Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Cold temperate and subarctic waters of the northern North Atlantic, including the Baltic Sea; south to Cape Cod and Portugal (IUCN 1991). Common off Cape Cod in spring; abundant at least seasonally off southern and western Greenland, Newfoundland, and Labrador, and throughout Davis Strait; common around the Faroe Islands; seasonally present in the Norwegian Sea along the coast of Norway and the southern Barents Sea to Varanger Fjord and possibly Murmansk; abundant off southwestern Sweden; the most common dolphin around Iceland; the third most commonly reported species in sighting and stranding records in the northern North Sea (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern North Atlantic, south to Cape Cod and Portugal. Baltic Sea.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Inhabits northern oceans (5), the distribution reaches north to Iceland, the Greenland Sea and around central-west Greenland (4), but this species is rarely seen further south than Britain and Ireland (5). It is common in UK and Irish waters, most often seen in the central and northern North Sea to north-west Scotland, but it also occurs less frequently in southern Ireland, the western Channel, and the Irish Sea (4). This species is most common in UK waters between June and September, but it is present throughout the year in northern British waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The white-beaked dolphin has a robust body, with a short, thick beak about 5-8 cm long in adults. The beak is distinctly set off from the melon. The dorsal fin is at mid-body. It is proportionally large (up to 15% of body length), often rounded at the peak, and strongly recurved. Both the dorsal fin and the flukes apparently decrease in size relative to other body dimensions as the dolphin ages. The pointed flippers can be up to 19% of the total adult length. The thickened tail stock tapers gradually, in marked contrast to that of the Atlantic white-sided dolphin (Reeves 1999).

The coloration of this species shows considerable variability. The beak of most white-beaked dolphins is white, often mottled with light grey or with greyish or blackish spots, but in some, it is almost entirely grey (though paler than the head). The dark dorsal field anterior to the dorsal fin is sometimes separated from the dark melon by a transverse light grey stripe, a brownish-grey patch or a bold whitish "chevron" around and behind the blowhole. It may extend downwards from the melon to encircle the eye. In front of the dark grey zones on the sides, there is a paler grey, rather ill-defined thoracic patch. Above and behind this patch, between the dark grey dorsal and lateral fields, the body is varying shades of light grey to nearly white. The whitish or light grey flank pigmentation extends dorsally onto the back behind the dorsal fin. The underside is white, with the white central part of the abdomen forming a narrow band between two pale grey patches. The flukes, the tail stock immediately in front of the flukes, and the flippers, are generally dark, but often spotted or marbled with white near the insertions of the flippers and on the undersides of the flukes. Four to six hair follicles are present on each side of the upper jaw. Hairs are present on the upper lip of young individuals (Reeves et al. 1999).

Average mass: 200 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 300 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 3.15 m (male)
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Range: 2.5-3.1 m males; 1.8-2.4 m females

Weight:
Range: up to 354 kg males; up to 306 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

White-beaked dolphins are rather large, robust dolphins. The back is dark grey and black, with a lighter ‘saddlespot’ behind the dorsal fin. A dark grey to whitish line can be found above the eye which continues over the flanks to the anus. The colour is highly variable. The body is fairly stocky. The beak is rather short and the flippers are large and pointed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

Distinguishing characteristics: robust body, with a short, thick beak about 5-8 cm long in adults. The beak is distinctly set off from the melon. The dorsal fin is at mid-body. It is proportionally large (up to 15% of body length), often rounded at the peak, and strongly recurved. Both the dorsal fin and the flukes apparently decrease in size relative to other body dimensions as the dolphin ages. The pointed flippers can be up to 19% of the total adult length. The thickened tail stock tapers gradually. The beak of most white-beaked dolphins is white, often mottled with light grey or with greyish or blackish spots, but in some it is almost entirely grey (though paler than the head). The dark dorsal field anterior to the dorsal fin is sometimes separated from the dark melon by a transverse light grey stripe, a brownish-grey patch or a bold whitish "chevron" around and behind the blowhole that may extend downwards from the melon to encircle the eye.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
White-beaked dolphins inhabit continental shelf and offshore waters of the cold temperate to subpolar zones, although there is evidence suggesting that their primary habitat is in waters less than 200 m deep. The species is found widely over the continental shelf, but especially along the shelf edge. A change in habitat use has been documented in U.S. waters, where white-beaked dolphins were observed primarily on the continental shelf prior to the 1970s, but mainly occurred over slope waters during the 1970s. This shift was associated with changes in finfish abundance and a shift in the distribution of Atlantic white-sided dolphins, L. acutus (Katona et al. 1993; Kenney et al. 1996).

The ecology of white-beaked dolphins has received little detailed study (Kinze 2002). They feed on variety of small pelagic schooling fishes but also demersal species (such as cod, haddock, poorcod, bib, hake, and whiting), squid, and crustaceans (Reeves et al. 1999). They sometimes associate, while feeding, with large whales (such as fin and humpback whales), and are known to form mixed groups with a number of other dolphin species (including bottlenose and Atlantic white-sided dolphins) (Reeves et al. 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lagenorhynchus albirostris generally occurs in cool waters. This species moves north into Davis Strait during the spring and summer, then moves back in the autumn and spends the winter as far south as Cape Cod (Nowak 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

inshore to mainly offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

temperate to subpolar, mostly in deep water
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1239 specimens in 1 taxon.
Water temperature and chemistry ranges based on 832 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.625 - 19.253
  Nitrate (umol/L): 1.028 - 8.636
  Salinity (PPS): 30.701 - 35.391
  Oxygen (ml/l): 5.401 - 8.121
  Phosphate (umol/l): 0.212 - 0.742
  Silicate (umol/l): 0.987 - 5.229

Graphical representation

Temperature range (°C): 0.625 - 19.253

Nitrate (umol/L): 1.028 - 8.636

Salinity (PPS): 30.701 - 35.391

Oxygen (ml/l): 5.401 - 8.121

Phosphate (umol/l): 0.212 - 0.742

Silicate (umol/l): 0.987 - 5.229
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Inhabits offshore and pelagic arctic waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The white-beaked dolphin is an offshore species although little is known about their prefered bathymetry.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cold temperate and subarctic marine waters.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Prefers cool waters (6), and spends most of the year in deep offshore waters, but may move closer to shore in summer (5). It is found widely over the continental shelf, but especially along the shelf edge (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Occurs at northern limits of range in warmer months; withdraws southward for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The principle prey of the white-beaked dolphin includes clupeids, gadids and hake. Other fish, squid, octopus and benthic crustaceans are also eaten (Reeves et al. 1999).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet includes squid, octopus, cod, herring, haddock, capelin, and sometimes benthic crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Squid and octopus, fish, and benthic crustaceans.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Occurs in groups of up to several hundred in the west, mainly in groups of not more than 2-5 in the east (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Calves are born between June and September. At birth they are about 115 cm long and weigh 40 kg. They reach sexual maturity at a length of 1.95 m (  http://ourworld.compuserve.com/homepages/jaap/lag-albi.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single calf is born June-September.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Little is known, probably mate in warmer months, with young born the next summer. Young are 1.2 m long at birth.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagenorhynchus albirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCTTGTATTTACTATTTGGCGCCTGGGCAGGAATAGTGGGCACTGGCCTAAGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGTACACTTATCGGAGACGACCAACTTTACAATGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATACCTATTATGATTGGAGGCTTTGGAAACTGACTCGTTCCCTTAATAATTGGAGCCCCCGACATAGCATTTCCCCGTTTAAACAATATAAGCTTCTGACTACTTCCTCCTTCCTTTCTACTACTGATAGCATCCTCGATAATTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTTACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACACCTCTCTTCGTCTGATCAGTCTTAGTTACAGCAATCTTACTTCTACTATCATTACCTGTCTTAGCAGCCGGAATTACTATACTACTAACTGATCGAAACCTAAACACAACTTTTTTCGACCCGGCAGGCGGAGGAGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGTCATCCCGAAGTATATATTCTAATTTTACCTGGCTTTGGAATAATCTCACATATTGTTACTTATTATTCGGGGAAAAAAGAACCTTTTGGGTACATGGGAATAGTATGAGCTATAGTTTCTATTGGCTTCCTGGGTTTCATTGTATGAGCTCACCATATGTTTACAGTTGGAATAGACGTAGACACACGAGCATATTTTACATCAGCTACCATGATTATTGCAATCCCTACAGGAGTAAAAGTTTTCAGTTGACTAGCAACACTCCACGGAGGAAATATTAAATGATCTCCTGCCCTAATATGAGCTCTAGGCTTTATTTTCTTATTCACAGTAGGAGGTTTAACCGGTATTATCCTAGCTAACTCATCCCTAGATATTATTCTCCACGATACCTATTATGTGGTTGCCCATTTCCACTATGTACTTTCAATAGGAGCTGTCTTCGCCATCATAGGAGGCTTCGTCCACTGATTTCCACTATTTTCAGGGTATACACTAAACCCAACATGAACAAAAATCCAATTCATAATTATATTTGTAGGTGTAAACATGACATTCTTCCCACAACACTTCCTAGGTCTATCTGGAATACCTCGCCGATACTCCGACTATCCAGATGCTTACACAACATGAAATACCATCTCATCAATAGGCTCATTTATCTCACTAACAGCAGTCATACTAATAATTTTCATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTACTAGCAGTAGACCTCACCTCCACAAATCTTGAGTGGCTAAACGGATGTCCTCCACCATACCACACATTTGAAGAACCAGTATACGTCAACCTAAAGTATTCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lagenorhynchus albirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Justification
The species is widespread and abundant (with current population estimates exceeding 100,000) and there have been no reported population declines or major threats identified.

History
  • 1996
    Lower Risk/least concern
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-beaked dolphins are hunted along the coasts of several Northern Atlantic countries including Norway, Iceland and Newfoundland. Like other North Atlantic marine mammals, white-beaked dolphins are poisoned by organochlorides, other anthropogenic compounds, and heavy metals. The impact of these factors on the population are unknown. Some populations have apparently grown in the last thirty years or so, while others (including those in the Gulf of Maine) have declined (Reeves 1999).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Accidental capture in fishing nets and occasional hunting by local peoples are known threats. Little is known regarding population numbers. There are no specific regulations dealing with this species.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive, Appendix II of the Bonn Convention (North and Baltic Sea populations) and Appendix II of the Bern Convention (3). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. In the UK all cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are few actual estimates of abundance, but there may be a hundred thousand or more throughout their range (Øien 1996, Reeves et al. 1999).

Published estimates indicate there are at least several thousand white-beaked dolphins in portions of the north-western Atlantic, shoreward of the 200-m contour between St. Anthony, Newfoundland, and Nain, Labrador (Alling and Whitehead 1987) and in coastal and offshore waters east of Newfoundland and south-east of Labrador. In the Gulf of St. Lawrence, white-beaked dolphins (2,500 in 1995 and 1996) occurred only in the Strait of Belle Isle and the extreme north-eastern Gulf (Kingsley and Reeves 1998).

At least a few thousand white-beaked dolphins inhabit Icelandic waters and up to 100,000 the northeastern Atlantic including the Barents Sea, the eastern part of the Norwegian Sea and the North Sea north of 56°N (Øien 1996). A survey of the North Sea and adjacent waters in 1994 provided an estimate of 7,856 (CV=0.30) white-beaked dolphins (Hammond et al. 2002). In 2005 there were an estimated 22,700 (CV=0.42) in the European Atlantic continental shelf waters, including 10,600 (CV=0.29) in the same area surveyed in 1994. Kinze et al. (1997) maintained that the white-beaked dolphin is much more common in the North and Baltic Seas than its relative, the Atlantic white-sided dolphin, and Northridge et al. (1997) found that white-beaked dolphins are relatively common in European waters compared with white-sided dolphins, or compared with US waters. A 2006 survey in an area from the Georges Bank to the upper Bay of Fundy to the entrance of the Gulf of St. Lawrence estimated 2,003 animals (CV=0.94) (Waring et al. 2008)

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Although not a target of any large commercial fisheries, there has been a long history of small-scale hunting for white-beaked dolphins in some countries, such as Norway, the Faroe Islands, Greenland, Iceland, and Labrador, mostly for food (Reeves et al. 1999); hunting in some areas continues today (Jefferson et al. 1993), e.g. some hunting continues off the south-west coast of Greenland (Kinze 2002) and opportunistically off the coast of Canada (Lien et al. 2001). During the early 1980s an estimated 366 white-beaked dolphins were taken annually by the residents of 12 Labrador harbours (Alling and Whitehead 1987).

White-beaked dolphins are known to be taken incidentally in a range of fishing gear throughout the range of the species (Dong et al. 1996; Reeves et al. 1999). In Norwegian waters where the species is abundant and fishery effort is high, bycatches of white-beaked dolphins are too rare to be detected in fishery operations monitored for marine mammal bycatches (A. Bjørge pers. comm.). In the UK bycatch observer programme, no white-beaked dolphins have been recorded (S. Northridge pers. comm.). Thus, recent bycatch monitoring programmers support the conclusion of Jefferson et al. (1993) that although known to be occurring, incidental catches are not thought to be high enough to represent a serious threat to this species.

Like other North Atlantic marine mammals, white-beaked dolphins are contaminated by organochlorines, other anthropogenic compounds and heavy metals (Reeves et al. 1999); although the effects of pollutants are not well understood in this species, they may affect reproduction or render them susceptible to other mortality factors.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No known serious threats, though some incidental take in fishing nets occurs (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known threats include environmental changes and the risk of entanglement in fishing nets (by-catch) and subsequent suffocation (5). Furthermore, this species has been hunted in Norway, the Faroe Islands and Greenland; this still persists in some areas (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

Existing direct takes are currently not regulated by any hunting quotas. Although known to occur, bycatch rates seem to be poorly documented and warrant more intensive research. The impact of combined anthropogenic removals should be assessed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, the white-beaked dolphin is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (4). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by seven European countries, including the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-beaked dolphin

The white-beaked dolphin (Lagenorhynchus albirostris) is a marine mammal belonging to the family Delphinidae (dolphins) in the suborder Odontoceti (toothed whales).

Contents

Taxonomy

The species was first described by the British taxonomist John Edward Gray in 1846. Due to its relative abundance in European waters it was among the first of the genus Lagenorhynchus (lagenos, Latin for "bottle" or "flask"; rhynchos, "beak" or "snout") to be known to science. Its specific name, albirostris, translates to "white beak", a reference to the color of the species' beak, a diagnostic (albeit variable) trait useful in identification.[2]

Description

Skeleton

The White-beaked dolphin is a robust species of dolphin with a short beak. Adults can reach 2.3 to 3.1 m (7 ft 7 in to 10 ft 2 in) long and weigh 180 to 354 kg (400 to 780 lb). Calves are 1.1 to 1.2 m (3 ft 7 in to 3 ft 10 in) long at birth and probably weigh about 40 kg (88 lb).[3] The dolphin is characterized by its short thick creamy-white beak and very falcate (curved) dorsal fin.

Distribution

The White-beaked dolphin is endemic to the North Atlantic Ocean and is found in a band stretching across the ocean from Cape Cod, the mouth of the St. Lawrence River and southern Greenland in the west, around Iceland in the centre and across in the west from northern France to Svalbard; however, it is not as well adapted to Arctic conditions as the beluga or narwhal. The dolphin may easily be misidentified as the Atlantic white-sided dolphin, although the White-beaked is commonly found further north. The White-beaked dolphin is also typically larger, and does not have yellow streaks on its side.

Behavior

A white-beaked dolphin off Iceland

The population, breeding pattern, and life expectancy of the dolphin are all unknown, although most sources estimate several hundred thousand individuals, more densely populated in the eastern North Atlantic than the west.

White-beaked dolphins are acrobatic and social animals. They will frequently ride on the bow wave of high-speed boats and jump clear of the sea's surface. The White-beaked dolphin is a social feeder and has frequently been observed feeding with Orca, Fin, and Humpback whales, as well as other dolphin species.

Conservation

The North and Baltic Sea populations of the White-beaked dolphin are listed on Appendix II[4] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS), since they have an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.[5]

In addition, the White-beaked dolphin is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS).[6]

See also

References

  1. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Lagenorhynchus albirostris. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 24 March 2009.
  2. ^ Reeves, Randall, Brent Stewart, Phillip Clapham and James Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Knopf. pp. 395–397. ISBN 0-375-41141-0. 
  3. ^ Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton Field Guides. pp. 199–200. ISBN 9780691127569. 
  4. ^ "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  5. ^ Convention on Migratory Species page on the White-beaked dolphin
  6. ^ Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas
  • Whales Dolphins and Porpoises, Mark Carwardine, Dorling Kindersley Handbooks, ISBN 0-7513-2781-6
  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, ISBN 0-375-41141-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!