Overview

Distribution

Geographic Range

Paralithodes camtschaticus is distributed throughout the northern Pacific Ocean. They can be found as far south as the Sea of Japan, and north up to the Kamchatka Peninsula. On the west coast of North America the southern limit is the Queen Charlotte Islands, and the most northern point is Barrow, Alaska. Paralithodes camtschaticus is also found in the southeastern Bering Sea. While not native to the Atlantic Ocean, P. camtschaticus was commercially introduced in the Barents Sea, north of Russia.

Biogeographic Regions: nearctic ; palearctic ; arctic ocean ; atlantic ocean (Introduced ); pacific ocean

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Ocean, North Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Paralithodes camtschaticus have a dark red body and are characterized by having a fan shaped tail. King crabs have 5 sets of appendages, the first two are pincers, the right is usually larger then the left. The last appendages are used for mating. For males the last two appendages are used to spread spermatophore over the genital opening of a female, and for females the appendages are used to aid in the spreading of the spermatophore.

Range mass: 12.7 (high) kg.

Average mass: 10 kg.

Average length: 220 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Adults are found in the intertidal zone at depths of more than 200 m in the preferred sand and mud substrates. Annual migrations from the deep to shallow waters (50 m or shallower) occur in the late winter/early spring for mating.

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: benthic ; coastal

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.1 - 419
  Temperature range (°C): 2.304 - 6.757
  Nitrate (umol/L): 8.920 - 35.169
  Salinity (PPS): 31.983 - 33.747
  Oxygen (ml/l): 2.881 - 7.224
  Phosphate (umol/l): 1.058 - 2.732
  Silicate (umol/l): 24.013 - 84.599

Graphical representation

Depth range (m): 0.1 - 419

Temperature range (°C): 2.304 - 6.757

Nitrate (umol/L): 8.920 - 35.169

Salinity (PPS): 31.983 - 33.747

Oxygen (ml/l): 2.881 - 7.224

Phosphate (umol/l): 1.058 - 2.732

Silicate (umol/l): 24.013 - 84.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Larval P. camtschaticus are planktivores. The adult form feeds on many different animals including some fish parts and are generalized carnivore.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; zooplankton

Plant Foods: algae; macroalgae ; phytoplankton

Primary Diet: carnivore (Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As adults, Alaskan king crabs are major predators. The mass numbers of zoea also serve as a food source for many organisms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

During the first year Alaskan king crabs hide in crevices formed by rocks or kelp forests to avoid predation. From the ages of 1 to 4 Alaskan king crabs form clusters of up to 500,000 individuals called pods. The pods disperse only for feeding. This behavior is thought to be used for protection during molting, when a crab is most vulnerable. The adult Alaskan king crabs have few predators because of their heavily armored and bumpy carapace. Carcinonemertes (nemertean worms) feed on eggs while mother is incubating. Erimacrus isenbeckii (Korean hair crab), Enhydra lutris (sea otters), and Heimlepidotus or Myoxocephalus (sculpins) are possible predators for adults.

Known Predators:

  • Warner , G. 1977. The Biology of Crabs. Great Britain: Pail Elek (Scientific Books) Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Alaskan king crabs communicate during mating when the female releases a chemical that signals a male that she is ready to ovulate.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Alaskan king crabs have two stages of development. In the first stage of development P. camtschaticus are free-swimming zoea. Zoea are very small and do not resemble the adult crab. During 3 to 4 months, the zoea molt 5 times. After the fifth molt the larval zoea begin to resemble the adult form, they are about 1/8 of an inch at this point, and adopt a benthic, or bottom dwelling, lifestyle.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The expected lifespan of P. camtschaticus is 15 to 20 years. The biggest non-commercial threat is molting. Molting can be stressful and cause death. In addition, the days after a molt are the most dangerous for P. camtschaticus, when the soft shell is vulnerable to predation. However, the main limit on life span for Alaskan king crabs is over-fishing.

Range lifespan

Status: wild:
20 to 30 years.

Typical lifespan

Status: wild:
15 to 20 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females attract males with a chemical that is released after eggs have hatched. The male then clasps onto the female and they remain connected until the female molts, and produces new eggs. Females mate once a year while males may mate multiple times each spring.

Mating System: polygynous

Female Alaskan king crabs mate immediately after the eggs hatch. During this process a male is attracted by a chemical that is released by the female. The male then clasps onto the female and holds her until she molts. The female and male may remain connected for up to 7 days. After molting the male uses his fifth pair of legs to spread spermatophores over the females opening. The females eggs are then released and pass over the spermatophores and become fertilized. These fertilized eggs are attached by the female to her pleopods under the abdomen and are incubated for approximately a year before hatching.

Breeding interval: Females breed once annually, while males can possibly mate with 11 females during the breeding season.

Breeding season: Alaskan King Crabs breed in the spring after migrating to water depths of 50 meters or less.

Range number of offspring: 150,000 to 400,000.

Range age at sexual or reproductive maturity (female): 5 to 6 years.

Range age at sexual or reproductive maturity (male): 5 to 6 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External )

Female Alaskan king crabs incubate eggs for 1 year, providing protection. Within days of hatching, the female begins incubating next group of eggs.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralithodes camtschaticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATTGGTACACTATATTTTATTTTCGGGGCTTGAGCTGGAATAGTGGGGACTTCTTTAAGTTTAATTATTCGAGCTGAACTAGGACAACCAGGTAGTTTGATTGGAGAT---GATCAAATCTATAATGTAGTTGTTACAGCACATGCCTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGACTAGTACCCCTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCCTCTTTAACTCTTTTATTAACTAGAGGTATAGTAGAAAGAGGAGTAGGAACAGGATGAACTGTTTACCCACCACTATCCGCAGCAATTGCACATGCAGGAGCATCAGTGGATTTAGGTATTTTTTCTTTGCATTTGGCTGGAGTATCTTCTATTTTAGGGGCTGTAAATTTTATAACTACAGTTATTAATATACGTCCACAAGGAATAACCTTAGACCGTATACCTTTATTTGTGTGATCCGTATTTATTACTGCAATTCTACTTTTATTATCACTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAACACCTCTTTTTTTGACCCTGCAGGAGGAGGAGACCCAGTTTTATACCAACATTTGTTTTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paralithodes camtschaticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

There is no special status on Alaskan king crabs. However, due to over harvesting the population of P. camtschaticus is consistently low. A proposed possible solution is that crabbers are only allowed to catch male Alaskan king crabs.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of P. camtschaticus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

From 1960 to 1970 Alaskan king crabs generated hundreds of millions of dollars in economic revenue. However, within two years of over fishing in a given area catch returns diminish to a fraction of the original catch. Now the United States gets the majority of its crab meat from the North Atlantic Ocean north of Russia. There is now a rule for fishers that they can only catch males.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Paralithodes camtschaticus

The red king crab, Paralithodes camtschaticus, is a species of king crab native to the Bering Sea. It grows to a leg span of 1.8 m (5.9 ft), and is heavily targeted by fisheries.

Contents

Description [edit]

Paralithodes camtschaticus can reach a leg span of 1.8 m (5.9 ft).

Red king crabs can be very large, sometimes reaching a carapace width of 28 cm (11 in) and a leg span of 1.8 m (6 ft).[2] It was named after the color it turns when it is cooked rather than the color of a living animal, which tends to be more burgundy.

Distribution [edit]

The king crab is native to the Bering Sea, north Pacific Ocean, around the Kamchatka Peninsula and neighbouring Alaskan waters. It was introduced artificially by the Soviet Union into the Murmansk Fjord, Barents Sea, during the 1960s to provide new, valuable catch for Soviet fishermen.

Fisheries [edit]

It is the most coveted of the commercially-sold king crab species, and is the most expensive per unit weight. It is most commonly caught in the Bering Sea and Norton Sound, Alaska, and is particularly difficult to catch, but is nonetheless one of the most preferred crabs for consumption.[3] The red king crabs are experiencing a steady decline in numbers in their native far east coastal waters for unclear reasons. Fishing controls set by the United States in the 1980s and 2000s have failed to stem the decline.[4]

In the Barents Sea, however, it is an invasive species and its population is increasing tremendously. This is causing great concern to local environmentalists and local fishermen as the crab eats everything it comes across and is spreading very rapidly. Since its introduction it has spread westwards along the Norwegian coast and also northwards, having reached the island group of Svalbard.[5][6] The species keeps on advancing southwards along the coast of Norway and some scientists think they are advancing at about 50 km (31 mi) a year, though that could be an underestimation.

Despite these concerns the species is protected by diplomatic accords between Norway and Russia, and a bilateral fishing commission decides how to manage the stocks and imposes fishing quotas. West of the North Cape on Norway's northern tip, the Scandinavian country is allowed to manage its crab population itself.[7] Only 259 Norwegian fishermen are allowed to catch it,[7] and they see the king crab as a blessing, as it is an expensive delicacy.

See also [edit]

References [edit]

  1. ^ Jørgensen, Lis Lindal (21 November 2006). "Invasive Alien Species Fact Sheet – Paralithodes camtschaticus". NOBANIS.org. Retrieved 20 February 2010. 
  2. ^ Jensen, Gregory (2004). "Order:Decapoda". In Hutchins, Michael. Grzimek's Animal Life Encyclopedia 2. Detroit: Thomson-Gale. p. 208. ISBN 0-7876-5362-4. 
  3. ^ "A meal to get your claws into". SeafoodfromNorway.com. 6 February 2006. Retrieved 20 February 2010. 
  4. ^ Blau, S. Forrest (November 1997). "Alaska King Crabs". Alaska Department of Fish and Game. Retrieved 20 February 2010. 
  5. ^ Bevanger, Lars (9 August 2006). "Norway fears giant crab invasion". BBC News. Retrieved 20 February 2010. 
  6. ^ Kirby, Alex (29 September 2003). "King crabs march towards the Pole". BBC News. Retrieved 20 February 2010. 
  7. ^ a b Deshayes, Pierre-Henry (24 May 2006). "Barents Sea teems with 'Stalin's crabs'". Mail & Guardian. Retrieved 20 February 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!