Overview

Distribution

Range Description

This species is distributed off the extreme northeastern coast of Brazil (Ceará, Rio Grande do Norte, and Pernambuco States) and the Central Atlantic Islands (São Pedro and São Paulo Archipelago, Fernando de Noronha, Rocas Atoll, Trinidad, Cape Verde, Canary, Ascension and Saint Helena) (Vianna 1986, Holthuis 1991, Pinheiro et al. 2003). The type locality of this species is Recife in Pernambuco State, Brazil (Holthuis 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This nocturnal species inhabits offshore regions with rocky substrates, and can be found in caves and crevices (Pinheiro et al. 2003, Pinheiro and Lins-Oliveira 2006). It can be found at depths of between 0 and 35 m, but is most commonly caught no deeper than 25 m (Holthuis 1991).

This species is an om­nivorous, opportunistic, and generalist feeder, consuming a great diversity of available prey from several trophic levels (Holthuis 1991, Góes and Lins-Oliveira 2009). It has been found to eat (in order of importance) fish, crustaceans, green algae, calcareous algae, and rocks (Góes and Lins-Oliveira 2009).

Male specimens have been found to be generally larger and heavier than females (Pinheiro et al. 2003). The carapace length for this species varies from 3-19 cm (males) and 2-15 cm (females), and the total body length varies from 7-39 cm (males) and 5-38 cm (females) (Holthuis 1991). It is thought that this size difference may be due to females hiding themselves away from predators during the breeding season, resulting in reduced foraging time; whereas foraging behaviour in males was found to be constant during the reproductive season (Pinheiro et al. 2003).

This species has an average fecundity equal to 56,160 eggs per female (lowest observed fecundity was approximately 44,000 eggs from a specimen of 16.5 cm total length (TL), while the largest observed fecundity was of 97,120 eggs from a specimen of 19.4 cm TL) (Pinheiro and Lins-Oliveira 2006). Amongst the three most commercially harvested species of Spiny Lobster in northeastern Brazil (this species, Panulirus argus and P. laevicauda), this species has the lowest reproductive potential, although this may be due to the reduced size of this species in comparison with the other two species (Pinheiro et al. 2003, Pinheiro and Lins-Oliveira 2006).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1.4 - 1.4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panulirus echinatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGCATGAGCAGGAATAGTAGGGACTTCCCTCAGTATTATCATTCGAGCCGAATTAGGCCAGCCAGGTAGATTTATCGGAGAC---GATCAAATTTACAACGTGGTAGTGACCGCTCACGCTTTCGTTATAATCTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGTAACTGACTAGTCCCAATCATGTTGGGGGCCCCTGACATGGCTTTCCCCCGTATAAATAACATGAGGTTCTGACTTCTACCCCCTTCTCTGACACTACTCTTAGCGGGTGGAGCGGTAGAAAGAGGTGCCGGCACTGGATGGACAGTTTACCCTCCCCTGTCAGCGGGAGTTGCCCACGCGGGAGCATCGGTAGATTTAAGTATCTTCTCTCTTCACTTAGCTGGTGTATCATCTATTTTAGGAGCCGTTAACTTCATCACAACCGTTATCAACATACGGTCATCCGGTATAACTCTAGACCGTATACCATTGTTTGTATGATCCGTATTCATCACGGCCATTCTACTCCTTCTCTCGCTTCCTGTCCTAGCCGGGGCCATTACCATGCTTCTTACCGACCGTAACTTAAACACTTCTTTCTTTGATCCGGTAGGAGGGGGGGACCCGATTCTTTACCAACACTTATTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panulirus echinatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Butler, M., Cockcroft, A. & MacDiarmid, A.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification

Panulirus echinatus has been assessed as Least Concern. This species is very widespread and has been described as abundant. Although it is harvested in most parts of its range there are no fisheries data available to indicate whether this is having significant impact on the global population. There have been declines, however the ecological characteristics of spiny lobsters make them relatively resistant to extinction as they need not aggregate to spawn, are highly fecund with well connected populations via long-lived larvae. Monitoring of population and catch-per-unit-effort data is recommended to create baseline data and allow interpretation of future trends. A management strategy for this species needs to be developed and enforced, particularly in northeastern Brazil to ensure the population remains at a sustainable level.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Edwards and Lubbock (1983 in Góes and Lins-Oliveira 2009) quote that this species was the most abundant decapod in the São Pedro and São Paulo Archipelago, Brazil. This species has been described as the most abundant coastal lobster in the Cape Verde Islands (Holthuis 1991).

Specific population information on this species is unavailable. There is no FAO data on catches of this species. From information known, this species is most likely over-exploited by legal and illegal harvesting throughout its range and the population will have decreased substantially from its original biomass. It is suspected, that in light of data from other lobster fisheries around the world, that the population has been reduced by at least 80 % (M. Butler, A. Cockcroft, and A. McDiarmid pers. comm 2009).


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threat facing this species is from harvesting. Although this species has been described as abundant in parts of its range, it is known that the stock of Spiny Lobsters in northeastern Brazil has been dramatically depleted in the last few decades. The lack of legislation currently protecting this species means that unless an appropriate management strategy is implemented it could be at risk of over-exploitation, especially in the northeastern Brazil part of its range (Pinheiro et al. 2003).

The stock of Spiny Lobsters in northeastern Brazil has been dramatically depleted in the last decades, mainly due to illegal and fishing activities. Increase in the fishery effort is due mainly to its high economic value added to the lack of appropriate legislation to protect the stock (Pinheiro et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Many recent studies have focused on investigating the life history traits of this species (Pinheiro et al. 2003, Pinheiro and Lins-Oliveira 2006, Góes and Lins-Oliveira 2009) and it is hoped that there is now enough ecological knowledge to impose the same fishery management strategies for this species as with similar species in northeastern Brazil.

The species is caught with lobster traps (Holthuis 1991), but is most frequently harvested by divers, a method not regulated by current legislation (Pinheiro et al. 2003).

It is suggested that there is the implementation of a minimum size limit, a fishing season, and no-take zones. In addition, long-term monitoring plans, in particular recording catch-per-unit-effort, should be applied in order to guarantee that the stocks of this species remain at sustainable levels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!