Overview

Comprehensive Description

Biology

Commonly found around mangroves and on tidal flats where vegetation is sparse and short (Ref. 5723). Not a seasonal killifish. Is difficult to maintain in aquarium (Ref. 27139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southeastern Florida, including the Keys (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southeastern Florida (including Keys) in USA. This species requires a new scientific name, since Fundulus similis is correctly a synonym of Fundulus majalis, having been based on the Gulf population of that species.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Florida to Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 1213
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 27139))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Shallow, mangrove-bordered flats and tidal lagoons with soft limestone mud, or slightly more solid coral base, substrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.225 - 0.755

Graphical representation

Depth range (m): 0.225 - 0.755
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Fundulus similis (Killifishes) preys on:
Macro-epiphytes
Nauplii2
Nauplii1
Foraminifera
Nematoda
Polychaeta
Harpacticoida
Pycnogonidae
Acartia tonsa
Elasmopus levis
Lembos rectangularis
Acunmindeutopus naglei
Synchelidium
Ampithoe longimana
Cymadusa compta
Batea catharinensis
Listriella barnardi
Lysianopsis alba
Caprella penantis
bacteria
meiofauna
Amphipoda
Lagodon rhomboides
Leiostomus xanthurus

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fundulus similis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTGTTTGGTGCCTGAGCCGGTATGGTGGGGACAGCTCTTAGTCTTCTCATCCGAGCTGAGCTGAGCCAACCAGGCTCTCTTTTAGGGGACGATCAGATTTATAATGTAATCGTAACAGCACATGCCTTTGTTATGATCTTCTTTATAGTAATACCTATTATGATTGGAGGTTTTGGTAATTGGCTTATTCCCCTGATAATTGGTGCCCCAGATATAGCATTTCCTCGAATGAACAATATGAGCTTTTGGCTCCTTCCCCCCTCATTTTTACTTCTATTAGCATCCTCCGGAGTCGAAGCAGGAGCAGGAACAGGCTGAACAGTCTACCCCCCTTTAGCAGGTAACCTAGCTCATGCAGGGGCTTCTGTAGATTTGACCATTTTCTCTCTCCATCTAGCTGGTATTTCATCGATTTTAGGAGCAATTAATTTCATTACTACTATTATTAATATGAAACCCCCAGCAATTTCACAATACCAAACCCCACTATTCGTCTGAGCTGTCCTAATTACTGCTGTTCTCCTCCTTTTATCTCTCCCAGTTCTTGCTGCAGGCATTACTATGCTTTTAACCGATCGAAACTTGAACACCACCTTCTTTGACCCNGCTGGTGGAGGAGACCCCATCCTATACCAACATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fundulus similis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fundulus similis

The Longnose killifish (Fundulus similis) is a freshwater tropical benthopelagic fish of the Fundulus genus and the Fundulidae family. It is endemic to the western Atlantic Ocean, ranging from northern South America to southern North America[1] It can grow up to 12 centimeters in length. The body is rounded, elongate, and olive to silver colored with dark vertical stripes. It can be distinguished from other killifish by its long snout and a dark spot on last vertical bar.[2]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Fundulus similis" in FishBase. April 2013 version.
  2. ^ "Longnose killifish". Texas Marine Species Identification. Retrieved 2013-09-12. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Relyea (1983) synonymized F. SIMILIS of southern Florida with F. MAJALIS because SIMILIS was based on the Gulf population of MAJALIS. The same author earlier had recommended (1967, Doctoral disser., Tulane Univ.) that populations from southeastern Florida and the Florida Keys be recognized as an undescribed species. Though recognizing that a new scientific name is needed, the 1991 AFS checklist (Robins et al. 1991) continued to use the name F. SIMILIS for the southeastern Florida population. The genus FUNDULUS was removed from Atheriniformes:Cyprinodontidae The genus FUNDULUS was removed from Atheriniformes:Cyprinodontidae and placed in Cyprinodontiformes:Fundulidae by Parenti (1981); pending confirmation based on other character suites, this change was not accepted in the 1991 AFS checklist (Robins et al. 1991). See Wiley (1986) for a study of the evolutionary relationships of FUNDULUS topminnows based on morphological characters. See Cashner et al. (1992) for an allozyme-based phylogenetic analysis of the genus FUNDULUS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!