Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coral-rich areas of seaward and clear lagoon reefs (Ref. 9710). Occur solitarily or in pairs. Creates 'cleaning ' stations to which fishes come to have crustacean ectoparasites and mucus removed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the west Pacific and eastern Indian Ocean, including Cocos-Keeling and Christmas Island to the Line and Pitcairn Group of Islands, north to the Bonin Islands, and south to Rowley Shoals and the Great Barrier Reef (Myers 1991, Allen 2000, Parenti and Randall 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific Ocean: Cocos-Keeling Island in the eastern Indian Ocean to the Line and Pitcairn islands, north to the Bonin Islands, south to Rowley Shoals and the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific and eastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 9 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 30874))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Identified by the mostly yellow head and black spot below the pectoral fin base (Ref. 48636). Scales on lateral line: 28 (+2 past hypural) (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Labroides pectoralis Randall & Springer
Catalog Number: USNM 209880
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Springer & M. Gomon
Year Collected: 1973
Locality: Nusa Laut, North Shore At Tandjung Tala (Tolo)., Indonesia, Moluccas, Pacific
Depth (m): 2 to 12
  • Paratype: Randall, J. E. & Springer, V. G. 1975. Uo. 25: 4-11 &.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits coral-rich areas of seaward, clear lagoon reefs (Lieske and Myers 1994, Allen 2000) and outer reefs (Kuiter 2002) at depths of 2 to 28 m (Myers 1991).

It is distinguished by the large black spot at lower edge of pectoral fin-base (Allen 2000, Kuiter 2002). It has been observed to “clean” parasites from other fishes (Randall and Springer 1975, Allen 2000). It is reported that the combination of colour and dance-like movement of L. pectoralis is an advertisement to other fishes, including predators, for “cleaning” services (Kuiter 2002). “Cleaning” included removal of parasite, dead tissue from wounds, food scraps from teeth or gills. Juveniles were observed to be territorial, working singly along reef walls, while adults work in pair and specifically at particular caves which are known as “cleaning stations” (Myers 1991, Kuiter 2002).

The mean plantktonic larval duration of L. pectoralis was 26.8 + / - 4.2 days and the highest larval duration was recorded to be 31 days in Palau (Victor 1986).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 28 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 3.05 - 40
  Temperature range (°C): 28.941 - 29.282
  Nitrate (umol/L): 0.116 - 0.156
  Salinity (PPS): 34.134 - 34.470
  Oxygen (ml/l): 4.496 - 4.641
  Phosphate (umol/l): 0.092 - 0.162
  Silicate (umol/l): 1.097 - 1.568

Graphical representation

Depth range (m): 3.05 - 40

Temperature range (°C): 28.941 - 29.282

Nitrate (umol/L): 0.116 - 0.156

Salinity (PPS): 34.134 - 34.470

Oxygen (ml/l): 4.496 - 4.641

Phosphate (umol/l): 0.092 - 0.162

Silicate (umol/l): 1.097 - 1.568
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 28m.
From 2 to 28 meters.

Habitat: reef-associated. Inhabits coral-rich areas of seaward and clear lagoon reefs (Ref. 9710). Usually in pairs. Creates 'cleaning ' stations to which fishes come to have crustacean ectoparasites and mucus removed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits coral-rich areas of seaward and clear lagoon reefs (Ref. 9710). Usually in pairs. Creates 'cleaning ' stations to which fishes come to have crustacean ectoparasites and mucus removed (Ref. 2334).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labroides pectoralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGCATGGTGGGAACGGCCCTGAGCCTACTCATCCGAGCTGAACTAAGCCAGCCCGGCGCTCTCCTTGGAGATGACCAAATCTACAACGTAATCGTTACAGCCCACGCGTTCGTAATGATCTTCTTTATAGTAATACCAATTATGATCGGGGGTTTCGGAAACTGGCTTATTCCCCTAATAATTGGAGCCCCTGACATGGCCTTTCCTCGAATAAACAATATGAGCTTTTGACTTCTACCGCCATCTTTCCTACTTCTTCTTGCTTCTTCTGGTGTTGAAGCAGGGGCTGGAACTGGTTGGACAGTTTATCCTCCCCTAGCTGGAAATTTAGCCCACGCGGGAGCTTCTGTTGATCTTACTATTTTTTCCCTTCACCTCGCCGGTATTTCATCTATCCTTGGGGCCATTAATTTTATTACAACTATTATTAATATGAAACCCCCTGCTATCTCTCAGTATCAAACACCCCTGTTTGTCTGAGCTGTACTAATTACAGCAGTCCTTCTTCTACTTTCCCTTCCGGTCCTTGCCGCTGGCATTACAATGCTCCTAACAGACCGAAATCTTAATACCACCTTCTTTGATCCTGCGGGAGGAGGGGATCCTATTTTATATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Labroides pectoralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S. & Liu, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is common in many parts of its range throughout the central west Pacific and east Indian Oceans. Although it is intensively collected for the aquarium trade, it is not thought to be contributing to widespread population decline. It is listed as Least Concern. More reseach is needed on sustainble harvest levels and the impact of collection on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in at least parts of its range. There is no other information available on the abundance of L. pectoralis. It is the most frequently observed species in Tutuila and Swains Island, Samoa (Brainard 2004), while in Micronesia, it is reported to be the smallest and least common cleaner wrasse (Myers 1991).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is targeted for the aquarium trade and there are occuring coral habitat degradation in parts of its range.

Overfishing, destructive fishing practices and pollution from the land have been reported within the area of highest coral reef diversity, such as the Philippines and Indonesia (Tun et al. 2004) and might cause habitat alteration or even loss. Such habitat alteration or degradation has been shown to influence the fish community (Öhman et al. 1997) and population depletions. Thus, habitat destruction might constitue as a main threat since most of this species habitat is in high coral cover areas.

The marine ornamental trade is an expanding industry and there is a threat of overcollection of the target species since most of them are taken from the wild (Ochavillo and Hodgson 2006). However, the data for the aquarium trade on is unregulated and with very limited documentation. There is no information available on the numbers that are being collected, location of extractions and monitoring on the trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.

It is worth mentioning that marine parks do not necessary imply as no take zones, for instance fishing and animal collections are allowed in the Sinub Island (Jenkins 2002). Given the intensive collection of this species for the aquarium trade, more research is need on the local and global impact of collection, as well as on the implementation of sustainable harvest and trade measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!