Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Despite being a rather small and slender shark, the strong swimming sharpnose sevengill shark is a voracious predator that is most active during the night (2) (4). It has a varied diet, feeding on a range of marine invertebrates, such as shrimp, lobsters, squid and cuttlefish, as well as small bony fish such as hake, small sharks and rays (2). This shark itself is thought to be preyed on by larger sharks (2). Although this shark is said to be quick to bite when captured, it is too small to be dangerous to humans (4). The sharpnose sevengill shark is an ovoviviparous species, a method of reproduction in which the young develop within eggs that remain inside the body until they hatch. Females give birth to between 9 and 20 young in a litter (4), each one measuring around 25 centimetres long (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The large, florescent green eyes of this slender shark may be its most noticeable feature as it moves silently though the ocean depths. As its name describes, this shark has a narrow, pointed head, a long, narrow mouth and seven gill slits down each side; most sharks have only five (2). The slim body is brownish-grey to olive on the upper surface, and paler on the underside, and it has only one small dorsal fin (2), the fin situated on the shark's back that helps prevent it from rolling in the water (3). Juvenile sharpnose sevengill sharks differ a little in appearance from adults, having dark blotches on the lower sides, and dark tips to the dorsal and tail fins (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found on the outer continental and insular shelves and upper slopes in depths of 100 to 400 (Ref. 13573, 11230), also inshore and down to 1,000 m (Ref. 6871, 11230). Feeds on small sharks and rays, small bony fish, shrimps, crabs, lobsters, squid, and cuttlefish (Ref. 5578). Ovoviviparous (Ref. 205), with 9-12 young born per litter (Ref. 247). Very active and aggressive when captured and quick to bite but too small to be very dangerous to people (Ref. 247). Liver utilized as a source of oil. Maximum length may reach 214 cm, but this is uncertain.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Azores Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Seychelles, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas, excluding the northeast Pacific (Ref. 13573). Western Atlantic: North Carolina, USA and northern Gulf of Mexico to Cuba, then from Venezuela to Argentina (Ref. 6871). Eastern Atlantic: Morocco to Namibia, including the Mediterranean Sea. Indian Ocean: southwestern India, Aldabra Island, southern Mozambique, and South Africa. Western Pacific: Japan to China, Indonesia, Australia and New Zealand. Southeast Pacific: off northern Chile.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Wide-ranging in all tropical and temperate seas except Eastern North Pacific. Usually regarded as dispersed, reported as aggregated or common in a few areas. Usually captured in 300 to 600 m, but occasionally taken in shallow water, and at depths to 1,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

off southern Virginia (36° 59' N, 74° 37 ' W), and south to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate sea (including Mediterranean Sea, Seychelles, Mascarenes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This shark has a very wide distribution, occurring in tropical and temperate seas worldwide (4), except the eastern north Pacific (1), although nowhere is it believed to be common (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0; Vertebrae: 125 - 161
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1370 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

137 cm TL (male/unsexed; (Ref. 247)); 140 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A narrow-headed, big-eyed small seven-gilled shark (Ref. 247). Body fusiform and slender; dorsal fin small, originating over inner margins of pelvic fins; anal fin small (Ref. 6871). Teeth wide, low and comb-shaped (Ref. 6871). Brownish grey above, paler below, sometimes with indistinct dark blotches on body; juveniles with dark-tipped dorsal and caudal fins, adults with light fin margins (Ref. 5578, 6574, 6871). Live specimens with fluorescent green eyes (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found on outer continental and insular shelves and upper slopes in depths of 100 to 400 m, also inshore and down to 400 m. Feeds on bony fishes, sharks (Ref.6574), hake, and squid. Ovoviviparous, number of young 9 to 20 in a litter. Probably strong-swimming. Generally, very active and aggresive. Quick to bite when captured, but too small to be very dangerous to people. Livers used in Japan for oil. Maximum lengh may reach 214 cm, but this is uncertain.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 0 - 1000 m (Ref. 41394), usually 180 - 450 m (Ref. 45445)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Marine, demersal to semi-pelagic, probably ranging well into midwater, on the upper continental slope, most commonly taken in 300 to 600 m, sometimes deeper, recorded to 1,000 m. Possibly aggregated near seamounts. Occasionally reports from shallow water are possible misidentifications. Undoubtedly an agile, voracious predator on pelagic fishes, squids, and crustaceans. Maximum size approximately 140 cm. Matures 75 to 85 cm (males), 90 to 105 (Females). Ovoviviparous, number of young 6 to 20 in a litter, size at birth 25 cm. May breed year-round, but gestation time and reproductive periodicity unknown. Otherwise virtually no information on biology, intrinsic rate of increase etc.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 173 specimens in 1 taxon.
Water temperature and chemistry ranges based on 88 samples.

Environmental ranges
  Depth range (m): 52.5 - 3148
  Temperature range (°C): 2.447 - 21.348
  Nitrate (umol/L): 1.020 - 37.580
  Salinity (PPS): 34.407 - 38.615
  Oxygen (ml/l): 0.769 - 6.265
  Phosphate (umol/l): 0.209 - 2.884
  Silicate (umol/l): 1.437 - 147.368

Graphical representation

Depth range (m): 52.5 - 3148

Temperature range (°C): 2.447 - 21.348

Nitrate (umol/L): 1.020 - 37.580

Salinity (PPS): 34.407 - 38.615

Oxygen (ml/l): 0.769 - 6.265

Phosphate (umol/l): 0.209 - 2.884

Silicate (umol/l): 1.437 - 147.368
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 27 - 1000m.
From 27 to 1000 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The sharpnose sevengill shark is found near the sea bottom, usually at depths between 27 and 720 metres, although occasionally is may also be found in shallower coastal waters, or in water as deep as 1,000 metres (4))
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the outer continental and insular shelves and upper slopes in depths of 100 to 400 (Ref. 11230, 13573, 75154), also inshore and down to 1,000 m (Ref. 6871, 11230). Feeds on small sharks and rays, small bony fish, shrimps, crabs, lobsters, squid, and cuttlefish (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, number of young 9 to 20 in a litter (Ref. 247). Size at birth about 25 cm (Ref. 6871). Distinct pairing with embrace (Ref. 205). No apparent seasonality in its reproduction cycle (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heptranchias perlo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAATTTTTGGTGCCTGAGCAGGAATAGTGGGTACAGCCCTAAGTCTACTTATTCGAACGGAATTAAGTCAACCCGGAACACTTTTAGGGGATGATCAGATTTATAATGTAATCGTTACTGCCCACGCTTTCGTAATAATCTTCTTCATGGTAATACCCGTAATAATTGGTGGATTCGGAAATTGACTAGTACCCTTAATAATTGGTGCTCCAGATATAGCTTTTCCACGAATAAATAATATAAGCTTCTGATTATTACCACCTTCATTCCTACTCCTTTTAGCCTCAGCTGGTGTAGAAGCAGGTGCCGGTACCGGTTGAACAGTTTATCCCCCACTTGCAAGCAATCTCGCTCATGCAGGAGCATCCGTAGACTTAACTATTTTTTCATTACATCTAGCTGGTATTTCCTCAATTTTAGCATCAATTAATTTCATCACCACTATCATTAATATAAAACCACCAGCTATCTCCCAATACCAGACCCCTCTTTTTGTTTGATCTATTTTCGTCACTACTATTTTACTTCTCCTTTCTCTCCCAGTCCTTGCAGCTGGAATTACTATATTATTAACTGATCGTAATCTTAATACAACATTCTTTGACCCCTCAGGAGGAGGAGACCCCATTCTCTACCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heptranchias perlo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Paul, L. & Fowler, S. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group (Shark Red List Authority)

Justification
A wide ranging, but relatively uncommon species where it occurs. Its centers of abundance may be at outer shelf, slope, and oceanic seamounts where commercial fisheries for other target species are likely to develop. It is likely to have a low intrinsic rate of increase, and poor resilience to depletion. This species is of minor commercial importance, but bycatch in bottom trawl and longline fisheries may have caused population declines where deepwater fisheries have been underway for several decades. Increased deepwater fishing effort in many regions is likely to affect populations in the future. The species is assessed as Near Threatened due to concern that it may meet the Vulnerable A2d+A3d+4d criteria.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No population/subpopulation information anywhere.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
A bycatch in some deepwater fisheries. Caught in small to moderate numbers as a bycatch of fisheries utilizing bottom or midwater trawls or as part of deepwater fisheries using bottom longlines to catch sharks or tilefish (Gulf of Mexico), but of minor commercial importance. Used for human consumption and presumably for fishmeal. Said to be good eating. Occasionally kept in captivity in Japan. Aggressive when captured, and even if not retained is likely to be killed.

Population status uncertain, but it is suspected that declines may have occurred in places where deepwater demersal trawl fisheries for shrimp and bony fishes have been operational over the past few decades (such as southern Mozambique). This shark is wide-ranging but relatively uncommon in most places where it occurs, and is taken by a wide variety of demersal fisheries. There are no data available on current and past catches, and species-specific catch data are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bycatch in fisheries is thought to be the greatest threat to the sharpnose sevengill shark, and may have caused populations to decline in areas where deepwater fisheries have been in operation for many years (1). It is captured in bottom trawls and by longlines, as fishermen target other, more commercially important, bottom-dwelling species, and is then eaten by humans or used for fishmeal (1). Although not considered to be threatened with extinction, an increase in fishing effort in deepwater regions inhabited by the sharpnose sevengill shark could have a detrimental affect on this slender species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in effect or proposed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are not known to be any conservation measures in place for the sharpnose sevengill shark (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sharpnose sevengill shark

The sharpnose sevengill shark (Heptranchias perlo) is a species of shark in the family Hexanchidae, and the only species in the genus Heptranchias. Found almost circumglobally in deep water, it is one of the few species of shark with seven pairs of gill slits as opposed to the usual five. The other shark species that has seven gill slits is the broadnose sevengill shark. Though small, this shark is an active, voracious predator of invertebrates and fishes. When caught, this species is notably aggressive and will attempt to bite. It is of minor commercial importance.[3]

Contents

Taxonomy

The genus name Heptranchias is from the Greek heptra meaning "seven arms", and agchein meaning "throttle", referring to this shark's seven pairs of gill slits. Other common names for this species include one-finned shark, perlon shark, sevengill cow shark, sevengilled Mediterranean shark, sevengilled shark, sharpnose seven-gill shark, snouted sevengill shark and slender sevengill shark.[4] Some authors believe that this species is distinct enough to merit its own family, Heptranchiidae.[5]

Distribution and habitat

The sharpnose sevengill shark is uncommon but widely distributed in the tropical and temperate regions of all oceans except for the northeastern Pacific Ocean. It is found from North Carolina to Cuba, including the northern Gulf of Mexico, and from Venezuela to Argentia in the western Atlantic. In the eastern Atlantic, it occurs from Morocco to Namibia, including the Mediterranean Sea. It is reported from the Indian Ocean off southwestern India, Aldabra Island, southern Mozambique, and South Africa. In the Pacific Ocean, it is known from Japan to China, Indonesia, Australia, New Zealand, and northern Chile.[4]

This is a demersal to semi-pelagic species usually captured at a depth of 300–600 m (980–2,000 ft), but is occasionally found close to the surface (though these reports may represent misidentifications) or down to 1,000 m (3,300 ft). It is mainly found on the outer continental shelf and upper continental slope, and may aggregate around seamounts.[2]

Description

Usually measuring 60–120 cm (2.0–3.9 ft) long, sharpnose sevengill sharks attain a maximum length of 1.4 m (4.6 ft). This species has a slender, fusiform body with a narrow, pointed head. The eyes are very large and fluoresce green in live specimens. The mouth is narrow and strongly curved, containing 9-11 teeth on either side of the upper jaw and 5 teeth on either side of the lower. The upper teeth are narrow and hook-shaped with small lateral cusps, while the lower teeth are broad and comb-shaped (except for a symmetrical symphysial tooth). Unlike most other sharks, there are seven pairs of gill slits that extend onto the throat.[4][6]

Drawing of a sharpnose sevengill shark.

There is only a single small dorsal fin located behind the pelvic fins, with a straight front margin, narrowly rounded tip, and concave rear margin. The pectoral fins are small with a weakly convex outer margin. The anal fin is small with nearly straight margins. The caudal peduncle is long, and the distance between the dorsal fin origin and the caudal fin is more than twice the dorsal fin base. The closely overlapping dermal denticles are very thin and transparent; each is longer than it is broad, bearing a distinct median ridge and two lateral ridges ending in marginal teeth. The coloration is brownish gray to olive above and lighter below; some individuals have dark blotches on the body or light posterior fin margins. Juveniles have dark blotches on the flank and dark tips on the dorsal fin and upper caudal lobe.[3][4]

Biology and ecology

Despite its relatively small size, the sharpnose sevengill shark is considered a top predator in the ecosystem it inhabits. At the Great Meteor Seamount in the eastern Atlantic, this species feeds primarily on teleosts and cephalopods, and to a lesser extent on small cartilaginous fishes. Off Tunisia, crustaceans are the second-most common prey taken after teleosts. Off Australia, this species consumes mostly teleosts, with smaller individuals taking mainly Lepidorhynchus denticulatus and larger individuals taking increasing numbers of snake mackerels and cutlassfishes.[7] It is a strong-swimming species, with feeding and activity level increasing at night. This species may be preyed upon by larger sharks. Known parasites of the sharpnose sevengill shark include nematodes in the genera Anisakis and Contracaecum, and the cestode Crossobothrium dohrnii.[4]

Reproduction is ovoviviparous, with no apparent reproductive season. The females give birth to litters of 9–20 pups; the newborns measure about 26 cm (10 in) long. Males mature at 75–85 cm (2.46–2.79 ft) long and females at 90–100 cm (3.0–3.3 ft). The onset of sexual maturation in males may be marked by the formation of mucus on the tips of the claspers.[3][4]

Relationship to humans

Small to moderate numbers of sharpnose sevengill sharks are captured as bycatch in certain deepwater commercial fisheries on longlines or in trawls.[2] They are utilized for fishmeal and liver oil; the meat is said to be of good quality but reported to be mildly poisonous.[4][6] When captured it is very active and quick to bite, but it does not pose a substantial threat to people due to its small size.[3] There is some concern that populations of this slow-reproducing species may be declining in areas of sustained deepwater fishing, and it has been assessed as Near Threatened by the World Conservation Union. It has occasionally been kept in captivity in Japan.[2]

See also

References

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera (Chondrichthyes entry)". Bulletins of American Paleontology 364: 560. http://strata.ummp.lsa.umich.edu/jack/showgenera.php?taxon=575&rank=class. Retrieved January 9, 2008.
  2. ^ a b c d Paul, L. and Fowler, S. (2003). "Heptranchias perlo". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41823. Retrieved May 11, 2006.
  3. ^ a b c d Compagno, Leonard J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. ISBN 92-5-101384-5.
  4. ^ a b c d e f g Bester, C. Biological Profiles: Sharpnose Sevengill Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on February 16, 2009.
  5. ^ Martin, R.A. Hexanchiformes: Cow Sharks. ReefQuest Centre for Shark Research. Retrieved on February 17, 2009.
  6. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2009). "Heptranchias perlo" in FishBase. February 2009 version.
  7. ^ Braccini, J.M. (November 19, 2008). "Feeding ecology of two high-order predators from south-eastern Australia: the coastal broadnose and the deepwater sharpnose sevengill sharks". Marine Ecology Progress Series 371: 273–284. doi:10.3354/meps07684.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!