Articles on this page are available in 2 other languages: Arabic (14), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits clear, flowing creeks, usually within 20 kilometers of the sea (Ref. 44894). Commonly found in brackish waters and river mouths. Occurs near mangroves, stagnant and running freshwater (Ref. 7300) and coastal areas (Ref. 45255). This species has a marine larval stage, judging from its broad distribution. One of the best viewing areas is at the Freshwater creek picnic ground in Cairns, where individuals frequently aggregate along the vegetated stream margin (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed in the Indo-Pacific, from India through Indonesia to northern Australia, southern Japan and the western Pacific to the Cook Islands (Rarotonga, the type locality) and into French Polynesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: India to New Guinea and New Caledonia, north to the Ryukyu Islands. Reported from Samoa (Ref. 592).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 9 - 10; Analspines: 3; Analsoft rays: 9 - 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 103 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.3 cm TL (male/unsexed; (Ref. 7050))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Resembles A. urotaenia, but differs in having large eye, and a gently-rounded snout. Eye diameter over 30% and interorbital width over 20% of head length. Cheek scales in 2 rows. Attains 8 cm TL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Ambassis lafa
Catalog Number: USNM 174744
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa: Apia, near mouth of Vaisigano River, Upolu, Samoa, Samoa Islands, Oceania
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Ambassis lafa
Catalog Number: USNM 51818
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa: Apia, near mouth of Vaisigano River, Upolu, Samoa, Samoa Islands, Oceania
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Ambassis lafa
Catalog Number: USNM 126228
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa: Apia, near mouth of Vaisigano River, Upolu, Samoa, Samoa Islands, Oceania
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species may be found in clear freshwater streams within 20 kilometres of the sea (Allen and Burgess 1990); or the lower reaches of rivers and streams, within freshwater (Keith et al. 2010). Pusey et al. (2004) collected this species in floodplain habitats as well as mangrove creeks and river estuaries in north Queensland.

Its food habits may depend upon habitat, with the species taking more crustaceans and small fish in estuaries than in freshwater, where terrestrial insects and their larvae are dominant (Pusey et al. 2004).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 3.5

Graphical representation

Depth range (m): 0.5 - 3.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on zooplankton and benthic animals (Ref. 11889).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Aontheca Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambassis miops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCTGAGCCGGTATAGTAGGTACAGCTTTAAGCCTACTTATCCGAGCAGAATTAAGCCAACCTGGCTCTCTCCTTGGAGATGATCAGATTTATAATGTTATCGTAACCGCGCATGCCTTCGTCATAATCTTCTTCATAGTTATACCAATTATGATTGGAGGCTTTGGAAACTGACTGGTCCCACTAATGATTGGAGCCCCAGACATGGCATTTCCCCGAATAAATAATATAAGCTTTTGACTTCTGCCTCCCTCGTTCCTTCTTCTCCTAGCCTCTTCAGGCGTAGAAGCAGGTGCCGGAACAGGTTGAACCGTCTACCCACCGCTAGCAGGTAACCTAGCCCATGCTGGGGCATCCGTAGACTTAACGATCTTCTCTCTACACTTAGCAGGTGTTTCTTCTATTTTAGGGGCAATTAACTTTATTACCACAATTATCAATATGAAACCCCCTGCCATTACTCAGTACCAAACTCCACTGTTCGTATGAGCTGTTCTCATTACAGCAGTTCTTTTACTTCTATCCCTGCCTGTCCTAGCCGCTGCCATTACTATGCTACTAACAGATCGAAATCTAAATACTTCTTTCTTTGATCCCGCAGGAGGCGGAGACCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambassis miops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Larson, H.

Reviewer/s
Hoese, D. & Keith, P.

Contributor/s

Justification
Due to this species' wide distribution and lack of any known major threats, it is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This widespread species can be locally common, but does not seem to be abundant (Pusey et al. 2004). There have been no population or reproductive studies on this fish.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No threats have been documented for this species, and its wide distribution likely affords it some protection.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs within several protected areas within its wide distribution (e.g. Wet Tropics World Heritage Area in Australia). It is listed as Non-threatened in Australia (Wager and Jackson 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!