Overview

Comprehensive Description

Biology

Adults inhabit lagoons and outer reefs. Oviparous, with elliptical eggs (Ref. 240). Monogamous (Ref. 52884). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, and Stichodactyla gigantea (Ref. 5911). Has been reared in captivity (Ref. 35428).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Red Sea and Chagos Archipelago.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Western Indian Ocean: Chagos Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 10; Dorsal soft rays (total): 15 - 17; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits lagoons and outer reefs, associated with the anemones @Entacmaea quadricolor@, @Heteractis aurora@, and @Stichodactyla gigantea@.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow orange with 2 black-edged white bands, the first running just behind the head, the second from the notch between the spinous and soft dorsal fin to the abdomen.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 2 - 12
  Temperature range (°C): 28.720 - 28.720
  Nitrate (umol/L): 0.862 - 0.862
  Salinity (PPS): 37.566 - 37.566
  Oxygen (ml/l): 4.314 - 4.314
  Phosphate (umol/l): 0.277 - 0.277
  Silicate (umol/l): 3.015 - 3.015

Graphical representation

Depth range (m): 2 - 12
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Inhabits lagoons and outer reefs, associated with the anemones @Entacmaea quadricolor@, @Heteractis aurora@, and @Stichodactyla gigantea@.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Sex reversal is completed in 26-145 days (Ref. 34185). In a field test, a functional male laid eggs in 26 days after removal of the female from the area (Ref. 240, 32167).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion bicinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGTTGATTCTTTTCGACCAATCACAAAGATATCGGCACCCTTTATCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTCTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGGGGGTTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTTCTGCTTGCCTCCTCGGGGGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTATACCCCCCACTGTCTGGAAACCTGGCCCATGCAGGAGCATCAGTAGACTTAACCATCTTCTCCCTCCACCTGGCAGGTGTCTCATCAATCCTGGGAGCAATCAACTTTATCACCACCATTATTAACATGAAACCCCCTGCCATCACACAATATCAAACCCCTCTATTTGTTTGAGCTGTTCTAATTACTGCTGTTCTTCTTCTCCTTTCTCTTCCAGTCTTAGCTGCCGGTATTACTATGCTCTTAACAGACCGAAATCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTCTACCAACACCTTTTCTGATTCTTCGGGCACCCAGAAGTATATATTCTTATCCTACCGGGGTTCGGAATGATCTCCCACATCGTAGCCTATTATTCTGGCAAAAAAGAACCATTCGGCTATATGGGCATGGTTTGAGCAATAATGGCCATCGGCCTACTAGGATTTATTGTATGAGCCCATCATATGTTTACAGTTGGCATAGATGTAGACACCCGAGCCTATTTCACATCCGCCACTATGATCATTGCTATCCCAACGGGTGTTAAAGTATTTAGCTGACTGGCCACTCTCCATGGAGGAACAGTAAAATGAGACACCCCTCTACTATGAGCTCTTGGCTTTATTTTCTTATTTACAGTTGGAGGCTTGACAGGAATCGTTCTTGCCAACTCTTCCCTAGACATTGTCCTTCACGACACCTACTATGTAGTAGCTCATTTCCACTATGTTCTTTCCATAGGAGCTGTCTTTGCAATTGTCGCCGGCTTCGTCCACTGATTCCCCCTATTCTCTGGCTACACCCTCCACACAACATGAACTAAAATCCACTTCGGAGTAATATTCGTGGGGGTTAATCTTACCTTCTTCCCACAACACTTCCTCGGGCTAGCTGGAATACCTCGACGATACTCTGACTACCCAGACGCTTACACCCTTTGAAACACAGTATCATCTATTGGATCCCTAGTCTCCCTTGTAGCCGTAATCATATTCCTATTTATTATCTGAGAAGCCTTCGCAGCCAAACGTGAAGTTCTCTGAGTTGAATTGACCTCAACTAACGTTGAATGACTCCACGGCTGCCCTCCCCCCTACCACACCTTTGAAGAACCTGCGTTTGTTCAAATCCAACAAACCTCACCAGAATATAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion bicinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red Sea clownfish

The Red Sea (or two-banded) clownfish / anemonefish (Amphiprion bicinctus), meaning "both sawlike with two stripes," is a clownfish of the family Pomacentridae.

Like other species of the genus, the fish feeds on algae and zooplankton in the wild.[1]

Description[edit]

Males grow to a length of 10 cm, and females grow to a length of 14 cm.[1] The fish's background color is yellow-orange with two black-edged white bands.

Distribution[edit]

The species comes from the Western Indian Ocean, the Red Sea, and the Chagos archipelago.[1]

Habitat[edit]

Monogamous pairs inhabit host anemones, usually on coral reefs. Host species include Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, and Stichodactyla gigantea.

Images[edit]

References[edit]

  1. ^ a b c Lougher, Tristan (2006). What Fish?: A Buyer's Guide to Marine Fish. Interpet Publishing. p. 12. ISBN 0-7641-3256-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!