Overview

Comprehensive Description

The species Megalops atlanticus ZBK Valenciennes is the unique representative of the family Megalopidae in the Brazilian coast. Only one exemplar was collected in the autumn and its distribution was similar to that of Elops ZBK sp. (Figure 4). Study Material: DZUFRJ 2722 one specimen; preanal myomeres 39-47; predorsal myomeres 39-44; LVBV myomeres44; total myomeres 54; 15.9 mm SL.

  • Marcia Salustiano de Castro, Ana Cristina Teixeira Bonecker (2005): Leptocephali collected off the eastern coast of Brazil (12 ° – 23 ° S). Zootaxa 935, 1-28: 4-4, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:3EA0A64C-D816-4404-8602-B8A4A37D170E
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: tarpon (English), sábalo (Espanol), tarpón (Espanol)
 
Megalops atlanticus Valenciennes in Cuvier & Valenciennes, 1847

Atlantic tarpon



Body oblong but elongate, strongly compressed; head short, deep, profile straight above, convex below; eye large; mouth large, oblique, opening above, lower jaw projecting; a long bony plate between lower jaws; teeth small, simple, on jaws, roof of mouth, tongue and lower base of gill arches; one dorsal fin, 13-16 rays,  last filamentous; anal fin base much larger than dorsal fin base; pelvic fins on abdomen; tail fin large, deeply forked; lateral line complete, tubes with branches radiating over surface of lateral line scales; scales very large, smooth; 41-48 on lateral line.

Bright silver, back greyish, fins grey.

        Size: 250 cm; 128.5 kg.

        
        Habitat: estuaries, occasionally around reefs; enters freshwater.

        Depth: 0-30 m.

Western Atlantic; presumably arrived in the eastern Pacific by passing through the Panama Canal; may now be established in the Gulf of Panama; not infrequently available at Panama City fishmarket.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabit coastal waters, bays, estuaries, mangrove-lined lagoons, and rivers (Ref. 3789, 27188). Often found in river mouths and bays, entering fresh water (Ref. 27227). Large schools may frequent particular spots for years (Ref. 9710). Feed on fishes like sardines, anchovies, Mugilidae, Centropomus, Cichlidae (mainly those forming schools) and crabs (Ref. 3789, 27188). The swim bladder, attached to the esophagus, can be filled directly with air and permits the fish to live in oxygen-poor waters. Has high fecundity, a 203 cm female is estimated to produce over 12 million eggs (Ref. 10863). Spawn in waters which can be temporarily isolated from the open sea (Ref. 27188). Transparent leptocephalus larvae migrate into estuaries (Ref. 57533). Famous for its spectacular leaps when hooked. Marketed fresh or salted (Ref. 3789). Large scales are used in ornamental work and in preparation of artificial pearls (Ref. 3789). Used to be cultured commercially in Colombia (Ref. 7306). Highly appreciated by sport fishers. The flesh is also highly appreciated despite its being bony (Ref. 27188). The world record for hook and line is 283 lbs. from Lake Maricaibo, Venezuela (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Megalops atlanticus) are large, deep-bodied fish commonly found in coastal and inshore waterways. Body color on the dorsal surface is generally dark blue or green to black, The sides and ventral surface are silver. Pelvic fins are abdominal, the caudal fin is deeply forked, and the single dorsal fin is short with a long, filamentous terminal fin ray. The scales of this species are large and cycloid, with 40-48 lateral scale lines. The mouth is large, with a protruding lower jaw. Members of the Family Elopidae have pronounced gular plates that span the lower jaw bones on the underside of the head.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Virginia (sometimes Nova Scotia), Bermuda, and Gulf of Mexico to Brazil; most abundant from southern Florida south. Also along west African coast. Occasional near Pacific end of Panama Canal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nova Scotia to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Megalops atlanticus is widely distributed in the western Atlantic from Virginia (there have been records from Nova Scotia), southward along the Gulf of Mexico and Rio de Janeiro, Brazil (Zale and Merrifield 1989, Crabtree et al. 1995). In the eastern Atlantic, it is distributed along the west coast of Africa, from Mauritania south to Angola (Anyanwu and Kusemiju 2008). Adults have been observed off the south coast of Ireland (Twomey and Byrne 1985). This species has also become established on the Pacific coast of Panama and has extended its distribution as far northward as Costa Rica, presumably via the Panama Canal (Swanson 1946).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Exotic (Introduced)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent, Continent only

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Senegal to Angola, with exceptional occurrences in Portugal, Azores and Atlantic coast of southern France. Western Atlantic: North Carolina, USA to Bahia, Brazil, with occasional occurrences off the American coast northward to Nova Scotia, Canada and southward to Cananéia, Brazil and Argentina. Throughout Gulf of Mexico and Caribbean (Ref. 26938). Eastern Central Pacific: Cobia Island in Panama via the Panama Canal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Megalops atlanticus, commonly known as the Atlantic tarpon, is primarily found in the warm, shallow, coastal regions of the eastern and western Atlantic Ocean. These fish have a wide range along the coastal areas from the United States to Brazil in the western Atlantic and from Senegal to the Congo on the eastern Atlantic coast. They have occasionally been sighted as far north as Nova Scotia and as far south as Argentina in the western Atlantic and along the coasts of Portugal, the Azores and the south of France in the eastern Atlantic. Megalops atlanticus is also found throughout the Caribbean, Gulf of Mexico, around Bermuda and in the eastern Pacific Ocean near Cobia Island in Panama because of movement through the Panama Canal.

Biogeographic Regions: nearctic (Native ); ethiopian (Native ); neotropical (Native ); atlantic ocean (Native ); pacific ocean (Introduced ); mediterranean sea (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Megalops atlanticus occurs in the Western Atlantic Ocean from Nova Scotia to Brazil, including Bermuda, the Caribbean, and the Gulf of Mexico. It is most common south of the Carolinas. Tarpon are distributed throughout the Indian River Lagoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical Atlantic, north to Porto Santo (Madeira), and associated estuaries, lagoons, and rivers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

From Brazil to Long Island, casually to Cape Cod and Nova Scotia. Mainly West Indies, around Florida, and in the Gulf of Mexico.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Hureau, J.-C., 1984; Boeseman, M., 1960; Boujard, T., M. Pascal, J. F. Meunier and P. Y. Le Bail, 1997; Whitehead, P. J. P. and R. Vergara, 1978; García, C. B. and O. D. Solano, 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 16; Analspines: 0; Analsoft rays: 22 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Megalops atlanticus is a large fish with a deep blue to black dorsal coloration and silver side and ventral coloration. Tarpon have a forked, homocercal caudal fin. The single dorsal fin is short and made up of 13 to 15 soft rays; the last of these rays is elongated into a heavy filament. The anal fin is a triangle and is made up of 22 to 25 soft rays; the last of these rays is also elongated into a filament but is much smaller than that of the dorsal fin. Tarpon have large pelvic fins on the abdomen and long pectoral fins made up of 13 to 15 soft rays. The scales of tarpon are cycloid and large. There are 37 to 42 of these large scales along the lateral line.

Tarpon vary greatly in size and females are generally larger than males. Megalops atlanticus can grow up to lengths of 240 cm and reach a mass of 161 kg. Females, on average, have a mean fork length of 167.7 cm whereas males have a mean fork length of 144.7 cm.

The lower jaw of M. atlanticus is large and protruding. Tarpon have very small, densely packed teeth placed all over the mouth including the jaws, tongue and skull base. In addition to these fine teeth, tarpon have a bony plate on the upturned portion of the lower jaw which helps them crush some of their prey.

Tarpon have a modified swim bladder which allows them to live in oxygen-poor environments. Alveolar tissue in the swim bladder and a duct connecting the swim bladder to the esophagus allow tarpon to breath atmospheric air. Studies have shown that tarpon are obligate air breathers. Even in oxygen-rich environments tarpon still gulp air from the surface.

Range mass: 161 (high) kg.

Range length: 204.5 (high) cm.

Average length: 156.2 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 250.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 245 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 2500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 2683)); max. published weight: 161.0 kg (Ref. 26340); max. reported age: 55 years (Ref. 9975)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

M. atlanticus can attain a size of 8 feet in length (2.4 m), weighing as much as 280 pounds (128.4 kg). Tarpon are sexually dimorphic, with females growing larger than males. A study by Crabtree et al. (1995) showed that of the 1,469 tarpon examined, mean fork length (FL) of large females sampled from the recreational fishery was 167.7 cm FL. Mean fork length among males sampled was 144.7 cm. Otolith examination shows that tarpon can also be extremely long-lived. Crabtree et al. (1995) reported that the oldest female tarpon examined in their study, which measured 204.5 cm in fork length, was approximately 55 years old, while the oldest male, which measured 171 cm fork length, was 43 years old.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 250 cm TL; max. weight: 161 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Hureau, J.-C., 1984; Boeseman, M., 1960; Boujard, T., M. Pascal, J. F. Meunier and P. Y. Le Bail, 1997; Whitehead, P. J. P. and R. Vergara, 1978; García, C. B. and O. D. Solano, 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal fin with short base at midlength of body. Anal fin with longer base, origin of posterior end at the level of the dorsal fin. Pectorals origin very low. Scales of the lateral line with ramified tubes. Blue gray back, shiny silvery sides. Swim bladder attached to esophagus and can be filled directly with air; this feature enables this species to live in oxygen-poor (brackish) waters. Large scales, 37-42 in lateral line (Ref. 26938). Last ray extended as heavy filament (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Larvae move from offshore waters to coastal waters and metamorphose. Juveniles occur in still and flowing dark waters of brackish marsh pools and creeks, larger juveniles in headwaters of brackish and freshwater streams and canals. Adults inhabit more open saline waters--shallow coastal waters, especially near or in bays and estuaries, also open ocean and occasionally coral reefs (Robins and Ray 1986), occasionally enter fresh water. Offshore pelagic spawner.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters.pelagic species, found to depths of 30 m, often in river mouths entering fresh water; some populations may complete their whole life cycle in fresh water.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The latitudinal distribution of Atlantic Tarpon is limited by sensitivity to low temperature (Zale and Merrifield 1989); in the extremes of their range, Tarpon experience winter thermal mortality circa 10ºC (Robins et al. 1977) and have an upper lethal thermal limit of 40ºC (Moffett and Randall 1957). Megalops atlanticus is tolerant of wide ranges in salinity and oxygen concentrations. Post-metamorphic juveniles are euryhaline, having been sampled from 0 to 45 PSU. The vascularized swim bladders of Tarpon allow aerial respiration, permitting juveniles to inhabit hypoxic inshore waters where they presumably experience low predation rates and have little competition for prey (Schlaifer and Breder 1940, Geiger et al. 2000, Seymour et al. 2004). Juvenile M. atlanticus habitats include stagnant pools, back waters, ephemeral coastal ponds and hurricane and storm overwashes, swales, and mangrove swamps and marshes, as well as man-made habitats such as mosquito impoundments and artificial wetlands (Dahl 1965, Wade 1962, Robins et al. 1977, Zerbi et al. 2001, Jud et al. 2011). These habitats are often extremely fragmented, which may have adverse effects on the population. Research is needed to document whether these habitats are sources or sink.

Late juvenile Tarpon utilize deep-water habitats such as canals and sloughs for emigration to coastal bays (Hunt pers. comm. in Kushlan and Lodge 1974). Adult tarpon (120 cm FL) are primarily coastal fishes that inhabit inshore waters and bays over a wide range of salinities (fresh to hypersaline) and temperatures (17–36°C) (Zale and Merrifield 1989, Crabtree et al.1995).

Tarpon may have resident, migratory, or mixed populations (Robins et al. 1977). Tagging studies indicate that some mature tarpon may undertake substantial and alongshore migrations (Ault et al. 2005, Luo et al. 2008), while others are residents of particular locations (Guindon unpublished data, sensu Robichaud and Rose 2004). These movements may represent repeated migratory patterns, or there may be significant annual variation in the movement pattern of individuals (Ault et al. 2008). Seasonal migrations may also occur. Migrations cross state and federal boundaries, which may impact regulation.

Diet
Juveniles start on a diet of zooplankton, small crustaceans, and insects (Harrington 1958). As older juveniles and adults begin to inhabit deeper-water habitats such as lagoons, creeks, canals, their diet transitions to larger crustaceans (penaeid shrimps, swimming crabs), polychaetes, and a suite of fishes as they grow (Whitehead and Vergara 1978, Boujard et al. 1997).

Reproduction and Development
Tarpon are batch spawners, and spawning season appears to vary by location. In Florida, spawning occurs presumably offshore from April through August (Smith 1980, Cyr 1991, Crabtree et al. 1992, 1995). Spawning in Costa Rica may occur year-round (Chacon-Chaverri 1993, Crabtree et al. 1997), similar to Puerto Rico, where peaks occur in March through May and July through September, respectively (Zerbi et al. 2001). In Brazil, spawning probably occurs from October through January (de Menezes and Paiva 1966). However, tarpon larvae have been recorded in the Gulf Stream through November (Harrington 1966), so spawning season may be prolonged or larvae may be transported long distances from more southern spawning locations. To date, active spawning events have not been directly observed.

Schools of gravid tarpon migrate from near-shore and inshore habitats to form large prespawning aggregations approximately 2–25 km offshore (Crabtree et al. 1992) presumably before moving up to 200-250 km offshore for spawning. The exact timing, cues, and zones of tarpon spawning have not been described, although it may be triggered by lunar cycles (Crabtree et al.1995).

Eggs and leptocephalus larvae have an extended oceanic planktonic stage (Phase I) followed by recruitment into fresh and brackish water nursery areas. Phase II begins at the onset of metamorphosis where larvae shrink in size from about 26 mm to 14 mm. Phase III is reflected by positive growth again through cycloid scale formation and is finished upon tarpon reaching sizes of ca. 40 mm in length (Harrington 1958,1966; Harrington and Harrington 1960). Phase II and Phase III larvae and juvenile tarpon will inhabit stagnant pools, back water, salt marsh and shallow mangrove lined areas that are low in dissolved oxygen and high in organic matter (Dahl 1965, Robins 1977, Zerbi et al. 2001). Metamorphosis is believed to take place in inshore waters. Age at recruitment to the estuary is 30–50 days (but recruiting larvae 20 days old have been captured in the Indian River Lagoon, Florida (Shenker et al. 2002).

Age and Growth
  • Size at recruitment: 1.4–3 cm SL
  • Age of recruitment: 30–34 days (20 days in the Indian River Lagoon (Shenker et al. 2002)).
  • Maximum age in captivity: 63 years (Shedd Aquarium) or up to 80 years (Andrews et al. 2001).
  • Maximimum age via validated otoliths from wild tarpon: males 43, female 55 (Crabtree et al. 1995). Radiometric ageing methods: 78
  • Maximum size: 200 cm; 263 cm in Brazil, from scale-derived estimates (De Menezes and Paiva 1966)
  • Size at first sexual maturity (cm FL)** female: 112.6 (Costa Rica) (Chacon-Chaverri 1993, Crabtree et al. 1997); 128.5 (US) (Crabtree et al. 1997); 130.0 (Brazil) (de Menezes and Paiva 1966)
  • Age at first maturity (female): 10 years (Crabtree et al. 1997); 12 in Costa Rica
  • Size at first maturity (male): 88.0 (US); 117.5 (US) (Crabtree et al. 1997); 100.0 (Brazil)
  • Age at first maturity (male): 7 in Costa Rica (Crabtree et al. 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 30 m (Ref. 3789), usually 0 - 15 m (Ref. 42064)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tarpon are found in estuaries, bays, lagoons and have even been known to travel up into freshwater rivers. Megalops atlanticus has the ability to tolerate euryhaline environments and can also tolerate environments which are oxygen poor by gulping air at the surface. The only environmental constraint on their habitat is temperature. They occupy warmer waters in subtropical areas and sudden temperature changes have been known to kill tarpon in large numbers. M. atlanticus is a pelagic fish.

Range depth: 0 to 30 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; rivers and streams; coastal ; brackish water

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 1414.5
  Temperature range (°C): 4.277 - 27.537
  Nitrate (umol/L): 0.286 - 24.779
  Salinity (PPS): 34.880 - 37.190
  Oxygen (ml/l): 4.613 - 4.887
  Phosphate (umol/l): 0.092 - 1.609
  Silicate (umol/l): 1.195 - 26.065

Graphical representation

Depth range (m): 0 - 1414.5

Temperature range (°C): 4.277 - 27.537

Nitrate (umol/L): 0.286 - 24.779

Salinity (PPS): 34.880 - 37.190

Oxygen (ml/l): 4.613 - 4.887

Phosphate (umol/l): 0.092 - 1.609

Silicate (umol/l): 1.195 - 26.065
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pelagic; freshwater; brackish; marine; depth to 30 m. Coastal waters, bays, estuaries, mangrove-lined lagoons, and rivers. Often found in river mouths and bays, entering fresh water. May form large schools that remain in a particular area.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Hureau, J.-C., 1984; Boeseman, M., 1960; Boujard, T., M. Pascal, J. F. Meunier and P. Y. Le Bail, 1997; Whitehead, P. J. P. and R. Vergara, 1978; García, C. B. and O. D. Solano, 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish, Freshwater

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Estuary, Freshwater, Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between offshore spawning areas and coastal waters (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Adults eat mainly fishes; juveniles eat fishes, copepods, ostracods, shrimps, and insects (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabit coastal waters, bays, estuaries, mangrove-lined lagoons, and rivers (Ref. 3789, 27188). Often found in river mouths and bays, entering freshwater (Ref. 27227). Large schools may frequent particular spots for years (Ref. 9710). Feed on fishes like sardines, anchovies, Mugilidae, Centropomus, Cichlidae (mainly those forming schools) and crabs (Ref. 3789, 27188). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of Megalops atlanticus changes throughout development. In the first stage of their development, tarpon get nutrients directly from the water. As juveniles, they feed on zooplankton, small fish, and insects. As adults, tarpon move away from zooplankton and feed only on fish and crustaceans. Some main food sources are Atlantic needlefish (Strongylura marina), pinfish (Lagodon rhomboides), and many species of crabs and shrimp. Megalops atlanticus swallows its prey whole because of the small size of its teeth. Tarpon feed mostly on mid-water prey during the day and night.

Animal Foods: fish; insects; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tarpon occurring in Florida and throughout the Gulf of Mexico feed primarily on species such as sardines, anchovies, mullet, snook, cichlids, and crabs (Whitehead and Vergara 1978). In a Costa Rican study (Chaverri 1994), smaller juvenile tarpon (<9 cm SL) fed primarily on copepods (40%), insects(23%), and detritus (26%); while larger juveniles (>9cm SL) fed primarily on fishes (30%), and insects (30%). A study conducted in Columbia (Catano and Garzon-Ferreira 1994) showed that smaller tarpon (12 - 53 cm) have diets which very according to habitat type and season. In spring, (March through May), tarpon sampled from river mouths in Columbia fed primarily on mullet (39%) and other fishes (43%). However, in fall (October to December), mollies and other poecilids composed the bulk of the diet (56%), with mullet (8%) and insects (17%) also included. Tarpon sampled from swamps in Columbia showed a similar pattern. In spring, mullet (37%), insects (21%) and penaeid shrimp (11%) composed the bulk of the diet; but in the fall, poecilids (65%) and insects (19%) are more prominent.Habitats: Tarpon occur in a variety of habitat types, from freshwater rivers and lakes to offshore waters. However, large tarpon, often the target of an economically important recreational fishery are found primarily in estuaries and nearshore coastal waters (Crabtree et al. 1995, Amos and Amos 1997). Tarpon spawn offshore, but larvae develop inshore.Benefit in IRL: The tarpon is highly prized as a recreational fish due to its tremendous strength and fast swimming speed. However, it is not valued as a food fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fishes (sardines, anchovies, Mugilidae, Centropomus, some Cichlidae) and crabs.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Hureau, J.-C., 1984; Boeseman, M., 1960; Boujard, T., M. Pascal, J. F. Meunier and P. Y. Le Bail, 1997; Whitehead, P. J. P. and R. Vergara, 1978; García, C. B. and O. D. Solano, 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Tarpon are prey and are also predators throughout their ecosystem. Large sharks, alligators and porpoises feed on tarpon and in return tarpon feed on smaller fish, crabs and shrimp.

Lecithochirium microstomum, a trematode parasite, is found in the stomachs of tarpon, and Bivescula tarponis, another trematode parasite, occurs throughout the intestines. The isopods Nerocila acuminata and Cymothoa oestrum, and the copepod Paralebion pearsei, are found on the external surfaces of tarpon. Commensal remoras often attach themselves to large tarpon and go along for the ride.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Zooplankton and small fish feed on M. atlanticus during the larval stage. As tarpon mature, their main predators become bull sharks (Carcharhinus leucas), great hammerhead sharks (Sphyrna lewini), American alligators (Alligator mississippiensis) and many species of porpoise.

Tarpon exhibit a color pattern called countershading, which most fish use as a method to prevent predation. Their dorsal surface is generally a dark color. When a predator is looking down on a tarpon from above, the dark color of its dorsal side helps it blend in with the dark, deep waters. The ventral surface of most fish is lighter in color, silver in the case of the tarpon. This countershading helps it blend in with the lighter color of the surface water when a predator is looking at it from below.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Megalops atlanticus (top carnivores-tarpon, barracuda, bull shark, other fish, American alligator, bald eagle,) preys on:
Melaniris chagresi
Gobiomorus dormitor
Actinopterygii
Aves

Based on studies in:
Panama, Gatun Lake (Lake or pond)
USA: Florida, Everglades (Estuarine)

This list may not be complete but is based on published studies.
  • W. E. Odum and E. J. Heald, The detritus-based food web of an estuarine mangrove community, In Estuarine Research, Vol. 1, Chemistry, Biology and the Estuarine System, Academic Press, New York, pp. 265-286, from p. 281 (1975).
  • T. M. Zaret and R. T. Paine, Species introduction in a tropical lake, Science 182:449-455 (1973), from p. 452.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Tarpon are common from the Atlantic coast of central Florida, around the Florida peninsula, the Gulf of Mexico, and the Caribbean. On the Western Florida coast, they are often observed in large schools 2-5 km offshore during the mid-summer spawning season. They become far less common north of North Carolina (Boschung et al. 1983), however, tarpon are known to occur as far north as Nova Scotia.Locomotion: Estimates of swimming speeds of tarpon in open water ranged from approximately 1 - 4 knots (Edwards 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Does not school but may form loose feeding aggregations (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on fishes like sardines, anchovies, Mugilidae, Centropomus, Cichilidae and crabs
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

The word "Megalops" translates from the Greek language as "large-eyed". The eyes of Megalops atlanticus are a very prominent feature and aid tarpon in hunting for prey. Tarpon have been known to make thumping noises to communicate with those around them or to scare off predators when they become startled. These noises are produced by vibrations in the swim bladder.

Communication Channels: acoustic

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Some populations may complete life cycle in freshwater, e.g. Lake Nicaragua in Central America, and Deep Lake in Florida (Ref. 4639).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Megalops atlanticus develops in three distinct stages over a period of months. Two to three days after spawning, the eggs hatch into planktonic leptocephalus larvae. Over a period of two to three months these leptochephalus larvae grow to a length of 6 to 25 mm and float inshore on currents to continue their development. In stage two, tarpon actually stop growing and shrink to a size of approximately 14 mm. This stage lasts anywhere from 20 to 25 days. In stage three, lasting seven to eight weeks, the tarpons continue their growth and at around 40 mm become juveniles.

The sexual maturation of M. atlanticus is based primarily on the length of the fish. In males it occurs between 90 to 117.5 cm and in females at approximately 128.5 cm. This maturation can occur between the ages of 6 to 13 years for both sexes.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Megalops atlanticus is known to have a very long lifespan. Tarpon are expected to live approximately 55 years in the wild and approximately 60 years in captivity. The oldest recorded age the wild was 55 years for a female and 43 years for a male. In captivity, the oldest recorded was a female tarpon which reached the age of 63 years.

Range lifespan

Status: wild:
55 for female and 43 for male (high) years.

Range lifespan

Status: captivity:
63 for a female (high) years.

Average lifespan

Status: wild:
55 years.

Average lifespan

Status: captivity:
55 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 55 years (wild) Observations: Unverified estimates suggest these animals may live up to 59 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns May-September. Larvae metamorphose after several months. Sexually mature in 6-7 years (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tarpon spawn seasonally and are multiple spawners. These fish have been seen swimming in a circular, rotating fashion. This movement may be a way for tarpon to initiate spawning. Large schools of Megalops atlanticus, 25 to 200 individuals, migrate offshore to spawn. Tarpon are broadcast spawners. Fertilization of the eggs is external.

Mating System: polygynandrous (promiscuous)

Large schools of Megalops atlanticus, 25 to 200 individuals, migrate offshore between May and August to spawn. There is some evidence to suggest that tarpon can spawn year round, but this is not common. There is also evidence to suggest that the lunar phase influences when tarpon spawn. Successful hatchings occur within the week following a new moon. These fish have a very high fecundity rate, with large females producing more than 12 million eggs. Tarpon spawn in the deeper waters and allow the currents to carry their eggs to inshore nurseries to develop. The eggs hatch into leptocephalus larvae after two or three days.

Breeding interval: Megalops atlanticus spawns once annually

Breeding season: Evidence now suggests that tarpon can spawn throughout the year, but most spawn May to August

Range number of offspring: 4.5 million to 20.7 million.

Average number of offspring: 12 million.

Range time to hatching: 2 to 3 days.

Range age at sexual or reproductive maturity (female): 6 to 13 years.

Range age at sexual or reproductive maturity (male): 6 to 13 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Tarpon expend energy travelling to their breeding grounds and producing their eggs and sperm, but they make no further investment in their offspring.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Male tarpon in Florida waters reach sexual maturity between 90 - 117.5 cm FL, while females mature at approximately 128.5 cm FL (Crabtree et al. 1997). Age at sexual maturity is estimated to be between 7 - 13 years of age (Garcia and Solano 1995). However, in Costa Rica, tarpon reach sexual maturity at a younger age than do Florida tarpon, and apparently do not grow to as large an adult size (Crabtree et al. 1997).Tarpon are highly fecund, with large females estimated to produce over 12 million eggs (Garcia and Solano 1995). Crabtree et al. (1997) estimated fecundity in Florida tarpon to range from 4.5 - 20.7 million oocytes per female, with larger fish producing proportionally more eggs. Data suggest tarpon spawn seasonally in Florida and are multiple spawners (Crabtree et al. 1997). Tarpon in Florida and the eastern Gulf of Mexico make extensive spawning migrations from inshore waters to offshore spawning grounds from May through July, with spawning occurring from May - August (Crabtree et al 1995, 1997). Large schools of tarpon, consisting of 25 - 200 individuals have been observed offshore in Florida waters during he early summer (Crabtree et al. 1992). In Costa Rica, spawning does not appear to be seasonal, and ripe females are commonly captured in all months (Crabtree et al. 1997).It has been suggested that lunar phase may be an important trigger for spawning activity. Data from Crabtree et al (1995) show that successful hatching of tarpon eggs occurs 3 - 5 days following a full moon, and 0 - 7 days following a new moon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female capable of producing over 12 million eggs. Spawn in waters which can be temporarily isolated from the open sea.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Hureau, J.-C., 1984; Boeseman, M., 1960; Boujard, T., M. Pascal, J. F. Meunier and P. Y. Le Bail, 1997; Whitehead, P. J. P. and R. Vergara, 1978; García, C. B. and O. D. Solano, 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Vitellogenic (yolked) eggs average 0.7 mm in diameter (Crabtree et al 1992). Eggs are spawned in offshore waters and hatch into leptocephali larvae after approximately 2 - 3 days. Leptocephali are distinguished by their elongate, compressed body form, which consist primarily of an acellular, mucinous matrix (Crabtree et al 1992). They also have slender, fang-like teeth, which are prominent in the head region. Leptocephali range in size from approximately 5.5 - 24.4 m standard length (SL) (Crabtree et al. 1992).The leptocephalus stage persists for 2 - 3 months (Crabtree 1995). during this period, leptocephali are transported on currents from offshore waters back to coastal waters, and eventually into estuaries where they complete development. Metamorphic larvae are most often found in mangrove-lined estuaries and in Spartina saltmarshes (Harrington 1958, Crabtree et al. 1995).Physical Tolerances: Tarpon are obligate air breathers (Edwards 1998) and are physostomous, meaning they possess a duct that connects the gas bladder to the esophagus. This anatomical feature allows the gas bladder to act as a lung, and enables tarpon to live in oxygen-poor waters (Bond 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Megalops atlanticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Megalops atlanticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGCTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTTTACCTAGTATTTGGTGCCTGGGCCGGAATAGTTGGAACAGCACTAAGCTTACTAATCCGGGCTGAGCTAAGCCAACCCGGGGCACTACTTGGTGATGACCAAATTTATAATGTCATCGTCACGGCACACGCCTTCGTAATAATCTTCTTTATAGTAATGCCTATTTTAATTGGTGGGTTTGGAAACTGACTAGTCCCTCTTATGATCGGGGCCCCAGACATAGCATTCCCCCGTATAAACAATATAAGCTTCTGGCTTCTCCCGCCGTCATTCCTTCTTCTGTTAGCTTCCTCGGGAGTCGAAGCGGGGGCAGGTACTGGATGAACAGTCTACCCTCCTCTTGCTGGTAACCTAGCCCACGCAGGTGCATCTGTAGACCTTACCATCTTTTCTCTCCACCTGGCAGGTGTCTCCTCAATCCTAGGCGCTATCAACTTTATTACTACAATTATCAACATAAAACCGCCCGCCATGTCACAATACCAAACACCACTATTCGTTTGATCTGTCTTAGTTACCGCAGTACTTCTCCTGCTATCTCTGCCGGTATTAGCTGCAGGTATTACTATACTCCTCACAGATCGCAATCTAAACACAACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCCTATACCAACACCTATTTTGATTCTTTGGACACCCAGAAGTTTATATCCTCATCCTGCCAGGATTTGGAATAATTTCCCATATCGTAGCCTACTACGCCGGTAAAAAAGAACCCTTTGGATACATGGGCATGGTTTGAGCAATAATAGCCATTGGTCTACTAGGATTCATTGTATGAGCACACCACATATTCACAGTAGGGATGGATGTGGACACTCGCGCTTATTTTACCTCCGCCACAATAATTATCGCAATTCCAACCGGTGTAAAAGTTTTCAGCTGGTTAGCAACCCTGCATGGCGGATCAATTAAATGAGACACCCCCCTCTTATGAGCTCTCGGATTTATTTTCTTATTTACCGTAGGGGGCCTAACCGGAATTGTCTTAGCAAACTCATCTATTGACATCGTCCTGCACGACACATACTACGTTGTAGCCCACTTCCACTATGTCCTGTCAATGGGAGCCGTATTTGCCATCATAGGGGCCTTTGTGCACTGATTCCCCCTATTTACAGGATATACACTTCACAGCACGTGGACAAAAATCCACTTTGGAGTAATATTTATTGGGGTAAACCTGACTTTCTTTCCCCAGCACTTCCTGGGACTAGCCGGAATACCCCGTCGATATTCAGACTACCCAGACGCCTACACTCTTTGAAACACAATCTCCTCAATTGGTTCCCTTATCTCACTAGTAGCTGTTATTATGTTCCTGTTCATCTTATGAGAGGCATTTGCAGCCAAACGAGAAGTCATGGCTGTGGAACTAACCATGACAAACGTAGAGTGACTACACGGCTGCCCCCCTCCGTACCACACATTCGAAGAACCAGCCTTCGTACAAATACAGTACACATTTACACACCCAGACCTTCTTAACCCTAACTACTACTGACGAGGAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2012

Assessor/s
Adams, A., Guindon, K., Horodysky, A., MacDonald, T., McBride, R., Shenker, J. & Ward, R.

Reviewer/s
Harwell, H. & Raynal, M.

Contributor/s

Justification
This species is widely distributed in the Western Atlantic, and it also occurs in the eastern Atlantic and on the Pacific coast of Panama, and has extended its distribution as far northward as Costa Rica, presumably via the Panama Canal. The major threats to this species are the consumptive fishery, habitat degradation and loss (especially to sexually immature individuals (0 to 9 years)) and bycatch mortality. The substantial loss of habitat, large directed recreational fisheries throughout its range, and evidence of regional declines raise concerns regarding long-term population stability. There has been no formal stock assessment of tarpon in any portion of the species' range; however, multiple lines of evidence suggest that populations of Atlantic tarpon appear to have declined from historic levels throughout their range (Adams et al. in review). Although patchy, data on total commercial landings in Central and South America show large historical declines. Total global landings of M. atlanticus declined 84.5% between 1965 and 2007 (4,600 metric tons versus 712 metric tons), particularly in Brazil, and mostly during the early years of that time period, reflecting a drop in population size, not a change in fishery effort (FAO 2011). Using a generation time of 12.7 years (Froese and Pauly 2008), the estimated decline in FAO landings over three generations (38 years, from 1969 to 2007) is at least 60%. Although this decline is driven largely from regional commercial harvest, specifically landings from Brazil, the major trends in population are mirrored in landings data from other regions, albeit from a much smaller magnitude. In the United States, this species is regulated and over the last decade, populations in Florida appear to have remained stable; however, earlier records are statistically unreliable. Anecdotal evidence from recreational fisheries in Florida and Texas (pre-1990) suggest significant declines. Therefore, we infer that the global decline in abundance is at least 30%. This species is currently listed as Vulnerable under A2bd. Additional information about the direction and magnitude of regional population trends will warrant future attention.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The effects of catch and release fishing programs on Megalops atlanticus are not yet fully understood. Releasing tired fish may make them unable to recover quickly. Tarpon may then die from oxygen deprivation or become easy prey for predators. Permits are now being issued to anglers who intend to catch and kill these fish. For a small permit price, two tarpon per licensed angler are allowed to be caught and killed each day. The angler must also report information on where the fish was caught and its size to the Florida Marine Research Institute for further tarpon research. This permit program has greatly reduced the number of tarpon killed over the past few years. In 1989, just before the permit program was instituted, it is estimated that 342 tarpon were caught and killed by anglers. In 1998, the number of tarpon caught and killed by anglers decreased to 70.

Commercial harvesting of M. atlanticus is not permitted.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In general, current estimations of abundance for this species are based on anecdotal evidence from the recreational fishery. In Florida, anglers suspect significant regional declines over the last 30–50 years, and anecdotal reports suggest declines compared to historic levels. Little scientific evidence exists to corroborate this. An analysis of the recreational Tarpon fishery in southwest Florida from 1902 through 1998 indicated that a decline in Tarpon captures began after the mid-1930s with a notable decrease during World War II (1941–45). The erratic pattern observed in this fishery could be attributed to the changes in social/recreational aspect of anglers recording data on a Tarpon scale or a decline in Tarpon landed by this fishery. There are no data currently available to test these two hypotheses. There is anecdotal information that the characteristics of the fishery changed from landings to catch-and-release, and there was a decline in recorded landings (White and Brennan 2010, Guindon 2011).

Similar to the reports from Florida, a decline was also observed in Texas in the late 1950s, although this decline appeared to be more dramatic (Ward pers. comm. 2011), and continued in the 1960s and 1970s (Winemiller and Dailey 2002). However, length modes did not decline over time as observed in Florida (Holt et al. 2005). Mechanisms for apparent declines may include habitat degradation and overfishing.

Florida state regulations granted Tarpon gamefish status in 1953, so they could not be commercially harvested or sold. By the 1970s, taxidermy was a booming million-dollar industry and Tarpon were killed routinely for mounts (Wade and Robins 1973), but the number of fish mounted each year began to decline in the mid-1970s (Crabtree unpublished data in Guindon 2011). In 1989, a new law was enacted and the harvest of Tarpon became regulated by Florida Statute. The number of harvest permits issued declined from 961 in 1989 to 280 in fiscal year 2009–2010, indicating a greatly reduced intended harvest, and a shift to a fishery that is almost entirely catch-and-release (Nelson 2002, Florida Fish and Wildlife Conservation Commission, unpublished data). In more recent years (1981–2010), most recreational catches of Atlantic Tarpon in the USA occurred along the Gulf of Mexico coast. Applying Florida sales of harvest permits to the Marine Recreational Fisheries Statistics Survey data for Tarpon caught and released in Florida, (personal communication from the National Marine Fisheries Service, Fisheries Statistics Division 2011), indicates that less than 1% of the total catch is harvested (Guindon 2011).

Over the last decade, populations in Florida appear to have remained stable; however, earlier records are statistically unreliable (Marine Recreational Fisheries Statistics Survey, National Oceanic and Atmospheric Administration 2011). One of the few estimates of a regional population of Atlantic Tarpon came from Boca Grande Pass. An acoustic survey was done in 1993, which estimated the Tarpon population in the Pass during peak spawning season to be between 24,700 and 25,400 individuals (Hedgepeth et al.1993). No similar data has been collected nor another population estimate made for this area since this study to determine whether or not abundance has increased or decreased. As this species is not primarily subjected to commercial fisheries, stock assessments have not been carried out throughout its range. Stock assessments or landings records in other parts of this species' range do not exist at present, particularly in developing countries.

There has been no formal stock assessment of Tarpon in any portion of the species' range; however, multiple lines of evidence suggest that populations of Atlantic Tarpon appear to have declined from historic levels throughout their range (Adams et al. in review). Although patchy, data on total commercial landings in Central and South America show large historical declines. Total global landings of M. atlanticus declined 84.5% between 1965 and 2007 (4,600 metric tons versus 712 metric tons), particularly in Brazil, and mostly during the early years of that time period, reflecting a drop in population size, not a change in fishery effort (FAO 2011). Using a generation time of 12.7 years (Froese and Pauly 2008), the estimated decline in FAO landings over three generations (38 years, from 1969 to 2007) is at least 60%. Although this decline is driven largely from regional commercial harvest, specifically landings from Brazil, the major trends in population are mirrored in landings data from other regions, albeit from a much smaller magnitude. Therefore, we infer that the global decline in abundance is at least 30% over the last three generation lengths.

Although more of the fishery appears to be trending toward catch and release, historically high levels of harvest (followed by dramatic declines) and continuing harvest in some areas, suggest cause for concern. In addition, M. atlanticus is a periodic species (Winemiller and Rose 1992), long-lived and late to mature, with correspondingly long generation length (>10 years), which may affect its resistance to and recovery from threats. Species with long generation lengths have correspondingly high population recovery time and are thus typically more susceptible to threats that cause population declines (Collette et al. 2011).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Threats to this species include effects of catch-and-release fishing (lethal and sub-lethal) (Guindon 2011), recreational harvest, commercial and subsistence fisheries in locations outside of the United States, habitat loss, freshwater flow alterations, declines in water quality, run-off, habitat fragmentation, and habitat alternation, such as dredging, and temperature extremes. This species is long-lived, which may affect its resilience to and recovery from threats.

In Texas, a study done by Holt et al. (2005), reported that there was no obvious decline in length modes with time among tarpon caught in the recreational fishery. It was indicated that larger tarpon tended to be caught in more recent years, this may be evidence of size selectivity by the fishers to retain larger fish for display or acknowledgement. The results of this study indicated that there may be a lack of recruitment of tarpon into the Texas fishery, especially from Mexico, after 1960, perhaps indicative of decline in nursery habitat. Alternatively, this could be due to natural fluctuations in recruitment.

Evidence of over-exploitation was observed in the southwest coast of Florida, in the decline in average length in the catches (Bortone 2008). Moreover, inshore waters where juvenile tarpon occur (Shenker et al. 2002) are subject to habitat degradation due to increased human activities (Bortone 2005). It should be noted, however, that Bortone used scales largely collected and posted from 1910–1930; very few scales were from collections after 1980. This coincides with a marked shift in Florida in the 1970s and 1980s towards a catch-and-release fishery (Guindon 2011).

Effects of catch-and-release fishing on tarpon has been studied in two size classes of Tarpon. Short-term, post-release mortality of adult tarpon in the recreational fishery is due predominately to predation, and to a lesser extent physiological stress and injury (Guindon 2011). In the absence of predation, estimated post-release mortality is 5% for the Gulf of Mexico coast of Florida. Other factors affecting survival of adult tarpon were the swimming condition of the tarpon at the time of release and hook location (Guindon 2011). The level of sub-lethal physiological stress was positively correlated with angling duration, handling time, and body size, especially in adult tarpon, whereas sub-adult tarpon showed less stress effects from angling (Guindon 2011). No short-term mortality was observed on juvenile tarpon released into a saltwater pond absent of sharks, and only one suffered mortality 43-hours after release. Delayed morality rates of adult tarpon are yet unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Despite their ecological and economic importance, recreational fishery regulations for tarpon in the United States and abroad differ regionally. Alabama and Georgia have size limits and bag limits (one per person per day in Georgia, in Alabama a $50 tag is needed). North and South Carolina have no minimum size requirements and the limit it one fish per person per day. In Louisiana and Mississippi, there are no regulations. In Florida and Texas, a permit is required to harvest or possess a tarpon (Florida Fish and Wildlife Conservation Commission, Guindon and Ward pers. comm. 2011). In Belize, Puerto Rico, and US Virgin Islands, tarpon are catch-and-release only. In Mexico, the limit is two fish per person per day but no minimum size requirement exists.

In an effort to conserve fish stocks and their habitats, many countries are using marine protected areas in conjunction with existing fisheries regulations to build sustainable fisheries and protect marine biodiversity. Catch-and-release is commonly practised by recreational anglers with a strong conservation ethic who travel to the region. Current levels of international harvest and by-catch should be quantified, and the tertiary effects of catch-and-release fishing on tarpon should be determined to help maintain, if present, or create, if needed, a sustainable fishery.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: "A spectacular game fish" (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There have been a few reported cases of ciguatera poisoning from eating tarpon. Ciguatera poisoning causes nausea, vomiting, and diarrhea. Neurological signs of poisoning include headache and temperature sensitivity and cardiovascular signs can include arrhythmia and reduced blood pressure. There have also been reports of injuries and even deaths to sport fishers attempting to catch tarpon. These fish are very large and have lots of thrashing power when hooked on a fishing line. When pulled into a boat they can thrash their bodies around vigorously and injure the angler. It is best to wear out the fish before pulling it on board to avoid any injury.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Tarpon mainly benefit humans through recreational activities. In Florida, tarpon are a very important game fish, bringing in millions of dollars annually through charter fishing trips. In some areas, Megalops atlanticus is marketed for its flesh. It is considered a delicacy in South America despite the fact that it is very bony. Large scales of tarpon are used as ornamentation on home decorations and are also used in the manufacturing of artificial pearls.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Indian River Lagoon generates approximately 731 million dollars annually to the Florida economy. Of this, approximately 465 million dollars is generated by recreational activities such as sport fishing, boating, water sports, hunting, and ecotourism activities (data provided by St. Johns River Water Management District). As the tarpon is among the most important of Florida's recreational species, it directly contributes to Florida's economy.Since 1989, implementation of a permit system in the tarpon fishery requires anglers to pre-purchase a $50.00 permit in order to harvest a tarpon. This process has resulted in a tremendous increase in catch-and-release fishing for this species, with approximately 100 fish per year legally harvested (Crabtree et al. 1995). Data from Edwards (1998) shows that release mortality in the tarpon fishery is low when fish are hooked in the jaw, are brought to the boat and released within a relatively short period of time, and are not removed from the water while being released. Fish handled in this manner were shown to recover quickly and resume normal activities within a short period of time. BIBLIOGRAPHYCatano, S., J. Garzon-Ferreira. 1994. Ecologia tropica del sabalo (Megalops atlanticus) (Pisces: Megalopidae) en el area de Cienaga Grande de Santa Marta, Caribe Columbiano. Rev. Bio. Trop. 42(3):673-684.Chaverri, D.C. 1994. Ecologia basica y alimentacion del sabalo (Megalops atlanticus) (Pisces: Megalopidae). Rev. Bio. Trop. 42(1/2):225-232.Crabtree, R.E., 1995. Relationship between lunar phase and spawning activity of tarpon (Megalops atlanticus), with notes on the distribution of larvae. Bull. Mar. Sci. 56(3):895-899.Crabtree, R.E., E.C. Cyr, R.E. Bishop, L.M. Falkenstein, J.M. Dean. 1992. Age and growth of tarpon (Megalops atlanticus) larvae in the eastern Gulf of Mexico, with notes on relative abundance and probable spawning areas. Env. Bio. of Fishes 35:361-370.Crabtree, R.E., E.C. Cyr, J.M. Dean. 1995. Age and growth of tarpon (Megalops atlanticus) from South Florida waters. Fish. Bull. 93(4):619-628.Crabtree, R.E., E.C. Cyr, D.C. Chaverri, W.O. McLarney, J.M. Davis. 1997. Reproduction of tarpon (Megalops atlanticus) from Florida and Costa Rican waters and notes on their ages and growth. Bull. Mar. Sci. 61(2):271-285.Edwards, R.E. 1998. Survival and movement patterns of released tarpon (Megalops atlanticus). Gulf of Mexico Science 1:1-7.Whitehead, P.J.P., R. Vergara. 1978. Megalopidae. In: W. Fischer (ed.) FAO species identification sheets for fishery purposes. Western Central Atlantic (Fishery Area 31) Volume 3. FAO, Rome.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic tarpon

The Atlantic tarpon (Megalops atlanticus) inhabits coastal waters, estuaries, lagoons, and rivers. tarpons feed almost exclusively on schooling fish and occasionally crabs. tarpons are capable of filling their swim bladder with air, like a primitive lung. This gives the tarpon a predatory advantage when oxygen levels in the water are low. Tarpons have been recorded at up to 2.5 m (8 ft 2 in) in length and weighing up to 161 kg (355 lb). The Atlantic tarpon is also known as the silver king.

In appearance, tarpons are greenish or bluish on top and silver on the sides. The large mouth is turned upwards and the lower jaw contains an elongated, bony plate. The last ray of the dorsal fin is much longer than the others, reaching nearly to the tail.

The Atlantic tarpon is found in the Atlantic Ocean, typically in tropical and subtropical regions, though it has been reported as far north as Nova Scotia and the Atlantic coast of southern France, and as far south as Argentina. As with all Elopiformes, it is found in coastal areas; it spawns at sea. Its diet includes small fish and crustaceans.[1]

The tarpon is the official state saltwater fish of Alabama.[2]

Fishing for tarpons[edit]

Atlantic tarpon

Tarpons are considered one of the great saltwater game fishes, not only because of their size and their accessible haunts, but also because of their fighting spirit when hooked; they are very strong, making spectacular leaps into the air. The flesh is undesirable and bony. In Florida and Alabama, a special permit is required to kill and keep a tarpon, so most tarpon fishing there is catch and release.

Although a variety of methods are used to fish for tarpons (bait, lure and fly on spinning, conventional or fly rod), the method that has garnered the most acclaim is flats-fishing with a fly rod. It is a sport akin to hunting, combining the best elements of hunting with fishing. A normal tarpon fly rod outfit uses 10–12 weight rods and reels, spooled with appropriate line and using a class leader tippet of 12–20 lb (5.4–9.1 kg); truly light tackle fishing where the fish may weigh 10 times or more than the breaking strength of the leader. Typically, an angler stations himself on the bow of a shallow-water boat known as a 'flats skiff', and with the aid of a guide, searches for incoming tarpon on the flats (inshore shallow areas of the ocean, typically no more than 3–4 ft (0.91–1.22 m) deep). When a school of tarpons are sighted, the guide positions the boat to intercept the fish. The angler usually has no more than six to 10 seconds to false cast out enough flyline and make an accurate cast to these fast-moving fish. Accuracy and speed are paramount, but the task is compounded by the inevitable excitement and nervousness of seeing a school of fish that may top 180 pounds (82 kg) bearing down on the angler. Once the cast is made, the fly is retrieved and hopefully a tarpon inhales the fly. The hookset is difficult due to the hard mouth of the fish, which has been likened to the hardness of concrete, so many tarpons throw the hook on the first few jumps; many times an angler is asked, "how many tarpons did you jump?" rather than how many they caught. If the hook stays secure, then the fight is on. Tarpons have tremendous endurance and are one of the most exciting gamefish to fight—frequent spectacular jumps, long runs, and stubborn bulldogging are all part of the game. Although an experienced and skillful tarpon angler can usually land a tarpon in less than an hour, the average angler usually takes longer, from one to more than three hours.

Another popular method is using lures or bait on heavy spinning or conventional gear. Many anglers prefer this as a more surefire method to catch tarpons. Usually, the reels are filled with line from 30- to 80-lb test although 50-lb (23-kg) test line seems to be the most popular. Although a great deal of fun, the outcome is less often in doubt, unlike fly fishing with light (20-lb test) line, and getting a tarpon to take a crab, mullet or pinfish is easier than an artificial fly.

Despite its namesake, the Atlantic tarpon is not limited to one body of water or exclusive to the East Coast. In their northern migration, tarpons range through the Florida Keys and gradually make their way up the west coast of Florida and on to the Texas coast. Of all the places where tarpons are found and fished, the one location most noted for easy access to large numbers of tarpons concentrated in a central location is Boca Grande Pass, on Florida's west coast. The attraction for the tarpons is the plentiful crabs and baitfish washed through the pass on an outgoing tide. The tarpon only need to position themselves along the bottom and gorge themselves as they attempt to avoid anglers. Numerous tournaments throughout the season, running from May through early August, attracts anglers from throughout the world.

The International Sábalo (tarpon) Fishing Tournament is held every May in Tecolutla on Mexico's Costa Esmeralda.

Geographical distribution and migration[edit]

Megalops atlanticus.jpg

Since tarpons are not commercially valuable as a food fish, very little has been documented concerning their geographical distribution and migrations. They inhabit both sides of the Atlantic Ocean. Their range in the eastern Atlantic has been reliably established from Senegal to the Congo. Tarpons inhabiting the western Atlantic are principally found to populate warmer coastal waters primarily in the Gulf of Mexico, Florida, and the West Indies. Nonetheless, tarpon are regularly caught by anglers at Cape Hatteras and as far as Nova Scotia, Bermuda, and south to Argentina. Scientific studies[3] indicate schools have routinely migrated through the Panama Canal from the Atlantic to the Pacific and back for over 70 years. They have not been shown to breed in the Pacific Ocean, but anecdotal evidence by tarpon fishing guides and anglers indicates it is possible, as over the last 60 years, many small juveniles and some mature giants have been caught and documented, principally on the Pacific side of Panama at the Bayano River, in the Gulf of San Miguel and its tributaries, Coiba Island in the Gulf of Chiriquí, and at Piñas Bay in the Gulf of Panama. Since Tarpons tolerate wide ranges in salinity throughout their lives and will eat almost anything dead or alive, their migrations seemingly are only limited by water temperatures. Tarpons prefer water temperatures of 72 to 82°F; below 60°F they become inactive, and temperatures under 40°F can be lethal.

See also[edit]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2005). "Megalops atlanticus" in FishBase. 05 2005 version.
  2. ^ "Official Alabama Saltwater Fish". Alabama Emblems, Symbols and Honors. Alabama Department of Archives & History. 2006-04-27. Retrieved 2007-03-18. 
  3. ^ The Panama Canal as a Passageway for Fishes, with Lists and Remarks on the Fishes and Invertebrates Observed, Samuel F. Hildebrand (1939)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!