Overview

Comprehensive Description

Biology

Gregarious. Occurs in fairly shallow water with fast current, often beside the swirls created by piles of bridges or rocks (Ref. 30578). Inhabits moderate to fast-flowing large to medium sized rivers with rock or gravel bottom. Larvae occur below surface and feeding larvae inhabit along shores. Early juveniles live on the bottom in very shallow shoreline habitats. When growing, they move from the shore for faster-flowing waters. Juveniles overwinter in backwaters or in cavities along shores. During winter, adults form dense swarms in lower parts of rivers. Larvae and early juveniles prey on small invertebrates while larger juveniles and adults feed on benthic diatoms and detritus. Migrates some tens of km to spawning sites, which are often located in tributaries. Spawns in fast flowing water on shallow gravel beds often in small tributaries (Ref. 59043). Reported to migrate upstream and enters small tributaries for spawning in shallow water on gravel (Ref. 556). Its flesh is good but bony (Ref. 30578). Locally threatened by damming, destruction of spawning sites and pollution. In drainages where it is introduced, this species outcompetes and eliminates Parachondrostoma toxostoma in Rhône and Protochondrostoma genei in Soca (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Basins of Black (Danube, Dniestr, South Bug and Dniepr drainages), southern Baltic (Nieman, Odra, Vistula) and southern North Seas (westward to Meuse). Invasive or introduced in Rhône, Loire, Hérault, Seine (France) and Soca (Italy, Slovenia) drainages.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe: Basins of Black (Danube, Dniestr, South Bug and Dniepr drainages), southern Baltic (Nieman, Odra, Vistula) and southern North Seas (westward to Meuse). Invasive or introduced in Rhône, Loire, Hérault, Seine (France) and Soca (Italy, Slovenia) drainages. Reports from the Drin drainage including Lakes Ohrid and Skadar represent a distinct species. In Appendix III of the Bern Convention (protected fauna).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 8 - 10; Analspines: 3; Analsoft rays: 9 - 11; Vertebrae: 47 - 48
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 556)); max. published weight: 1,500 g (Ref. 556); max. reported age: 15 years (Ref. 30578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from congeners in Black and Caspian Sea basins by the following characters: straight mouth in individuals larger than 20 cm SL, lower lip with thick cornified sheath; dorsal fin with 9½ branched rays; anal fin with 10-11½ branched rays; scales on lateral line 52-66 (usually 60-63); eye large, diameter 50-65% of interorbital distance; and side lacking broad dark midlateral stripe. Differs from species of Chondrostoma, Protochondrostoma and Parachondrostoma in Atlantic, Adriatic and Mediterranean basins of France, Italy and Slovenia by having the following features: mouth straight, lower lip with thick cornified sheath; 27-36 gill rakers; anal fin with 10-11½ branched rays; and pectoral, pelvic, anal and caudal fins red (Ref. 59043). (Ref. 59043). Caudal fin with 19 to 21 rays (Ref. 40476).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Moderate to fast-flowing large to medium sized rivers with rock or gravel bottom. Spawns in fast-flowing water on shallow gravel beds often in small tributaries. May show a strong size related longitudinal distribution in smaller rivers, with adults inhabiting more upper river stretches.

Biology:
Lives up to 12 years. Spawns for the first time at 4-5 years. May migrates some tens of km to spawning sites, which are often situated in tributaries, but which it does not inhabit in summer. Spawns in March-May when temperature reaches 12°C. Males form large aggregations, each male defending a small territory. Females spawn only once a year and, in some populations, during a very short period (3-5 days). Females deposit the sticky eggs into excavations made in gravel. Feeding larvae live along shores. Larvae live below surface. Early juveniles are benthic and inhabit very shallow shoreline habitats. When growing, they leave the shores for faster-flowing waters. Recruitment is closely related to high spring temperature, absence of spring floods and available shallow-water habitats along shores. Juveniles overwinter in backwaters or in cavities along shores. Adults form dense swarms during winter in lower parts of rivers. Larvae and early juveniles with superior mouth feed on small invertebrates. Larger juveniles and adults, which have inferior mouth, feed on benthic diatoms and detritus cleaned up from hard substrate in habitats with strong current.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Gregarious. Occurs in fairly shallow water with fast current, often beside the swirls created by piles of bridges or rocks (Ref. 30578). Found in the upper reaches of rivers. Feeds on algal growth on stones, which are scraped away with the use of its sharp, low, slit-like mouth. Migrates upstream and enters small tributaries for spawning in shallow water on gravel (Ref. 556).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Migrates some tens of km to spawning sites, which are often located in tribbutaries. Males form large aggregations, each male defending a small territory. Females spawn only once a year and in some populations, during a very short period of 3-5 days. Females lay sticky eggs into excavations made in gravel (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chondrostoma nasus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chondrostoma nasus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGGGCCGGAATGGTGGGGACTGCCCTAAGCCTCCTAATTCGGGCCGAACTAAGCCAACCCGGGTCACTTTTAGGTGATGACCAAATTTATAATGTCATCGTCACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATCGGGGGATTTGGAAACTGACTTGTCCCACTAATAATTGGTGCACCCGACATGGCATTTCCACGAATAAATAACATGAGCTTCTGACTTCTACCCCCCTCATTCCTCTTATTATTAGCCTCTTCTGGAGTTGAGGCCGGGGCCGGAACGGGGTGAACAGTATACCCGCCGCTTGCAGGCAATCTTGCCCACGCAGGTGCATCAGTAGATTTAACAATCTTCTCACTTCACCTGGCAGGTGTATCATCAATTTTAGGCGCAGTCAACTTCATTACCACAATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAGACACCTCTCTTTGTATGAGCCGTGCTAGTAACAGCCGTGCTTCTCCTCCTATCACTACCAGTTTTAGCTGCCGGAATCACTATGCTTCTTACAGATCGTAATCTTAACACCACATTCTTCGACCCGGCAGGAGGAGGAGACCCAATCCTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Freyhof, J.

Reviewer/s
Kottelat, M. & Smith, K.

Contributor/s
Kottelat, M.

Justification
Widespread but locally threatened due to damming, destruction of spawning sites and pollution.

European Union 27 = LC. Same rationale as above.


History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Damming, destruction of spawning sites and pollution
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common nase

The common nase (Chondrostoma nasus) is a European potamodromous cyprinid fish. It is often simply called the nase, but that can refer to any species of its genus Chondrostoma. Another name is sneep.

Distribution[edit]

The nase is found naturally in drainages of the Black Sea (Danube, Dniestr, Southern Bug, Dniepr), the southern Baltic Sea (Nieman, Odra, Vistula) and the southern North Sea (to Meuse in the west). Moreover it has been introduced to the Rhône, Loire, Hérault, and Soca (Italy, Slovenia) drainages. It is a migratory fish.

Appearance[edit]

The nase has a spindle shaped physique, with a blue-grey metallic-coloured scales and orange tail. It has relatively sharp lower lip. Generally, the fish range from 25 to 40 centimetres in length, and weigh about 1000 grams. However, specimens have been recorded up to 50 cm long and 1.5 kg in weight. The maximum recorded life span of the fish is 15 years.

Biology[edit]

This gregarious species is found in deep water with a fast current, often in the back waters of bridges or in rocky outcrops. It dwells near the bottom where it feeds on algae and other aquatic plants. Nase fish on the whole stay in shoals.

Protection[edit]

The nase is protected by the Convention on the Conservation of European Wildlife and Natural Habitats.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!